What Is The Key To The Recognition Of Codominance?

Question 5

What is the key to the recognition of codominance?

A- The alleles affect more than one trait.
B- The phenotype of the heterozygote falls between the phenotypes of the homozygotes.
C- The heterozygote expresses the phenotype of both homozygotes.
D- The trait exhibits a continuous distribution.
E- The dominant allele is not always expressed.

Question 22

Answer the next questions using the pedigree below. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing.

What would be the genotype of individual number 1?

A- None of the alleles can be determined
B- D_
C- dd
D- Dd
E- DD

Question 25

Answer the question using the pedigree above. Assume that deafness (dd) is caused by a single gene and is recessive to Hearing. Given that individual #4 and an another individual with genotype Dd are married and want to have children. What is the probability that they have a deaf girl?

A- 0%
B- Cannot be determined from the data
C- 50%
D- 25%
E- 12.5%

Question 26

My wife and I had three girls in a row, Amber, Melissa, and Camila and we recently had a little baby boy (so 3:1 ratio girls to boys). What is the chance that our next child (assume we have not determined the gender) will be male?

A- 25%
B- 33%
C- 67%
D- 50%
E- 75%

Question 30

Given the template DNA strand TACACCTCCCTACTACTCCCGGGATC, and that the string of bases CTACTACT represents an intron region. What is the mRNA processed transcript?

Ans:

Question 33

Based on the phylogenetic tree below, which of the following is most correct?

A- HIV is not related to SIV because Humans did not evolve from chimps
B- HIV evolved multiple times from SIV
C- Since humans are more evolved than chimps, HIV is more evolved than SIV
D- HIV M evolved from HIV O

Question 38

The image below shows evidence from a RFLP analysis from your DNA forensics lab. The defendant testified that the blood on his clothes was his own. What statement below best fits this testimony.

A- He has a valid point because some of the lines seem to match up.
B- It could have been anyone’s blood.
C- He is telling the truth because he is under oath
D- The pattern clearly shows that the blood matches the victims blood
E- There is no way to tell if the blood really is his because it had already dried

Question 41

What is the approximate probability of someone else having the same STR Profile as the one in this figure:

Use the table below to calculate the probability.
Locus Allele Frequency
D3S1358 12 0.015
D3S1358 13 0.015
D3S1358 14 0.1341
D3S1358 15 0.2896
D3S1358 16 0.2287
D3S1358 17 0.1616
D3S1358 18 0.1616
D3S1358 19 0.0152

VWA 12 0.015
VWA 14 0.1311
VWA 15 0.1189
VWA 16 0.186
VWA 17 0.2774
VWA 18 0.189
VWA 19 0.0884
VWA 20 0.015

FGA 18 0.015
FGA 19 0.061
FGA 20 0.125
FGA 21 0.1799
FGA 22 0.2287
FGA 23 0.1311
FGA 24 0.1463
FGA 25 0.0945
FGA 26 0.0183
FGA 27 0.015

A- 39 out of 10,000
B- 12 out of 1000
C- 12 out of a billion
D- 39 out of 1,000,000 people

Question 3

What is the difference between discovery science and hypothesis-driven science?

A- Discovery science involves predictions about outcomes, whereas hypothesis-driven science involves tentative answers to specific questions.
B- Discovery science is based on deductive reasoning, whereas hypothesis-driven science is based on inductive reasoning.
C- Discovery science “discovers” new knowledge, whereas hypothesis-driven science does not.
D- There is no difference between them.
E- Discovery science is mostly about describing nature, whereas hypothesis-driven science tries to explain nature.

Question 4

Aside from Natural selection, Darwin was the first biologist to propose:

A- Mutations in the genes can lead to new variation
B- genetic inheritance, stonger genes in parents lead to stronger genes in the offspring
C- Tree like structure to describe evolution
D- Darwin did not propose anything new aside from natural selection.
E- The evolution of species over time

Question 6

Which of these would Darwin not agree with:

A- The idea that individuals striving to survive leads to better adapted species
B- Evolution via natural selection requires long amounts of time
C- Common ancestry for all of life
D- Significant weight should be given to geology and fossils as evidence of evolution

Question 8

Natural selection always results in ______.

A- an increase in the size of a population
B- increased genetic variation
C- offspring better adapted to a future environment
D- a decrease in the size of a population
E- offspring better adapted to their parents’ environment than were their parents

Question 11

Which of the following is a characteristic of a non-trivial organization system?

A- Only experts in the field would be able to understand it
B- You get more out of it than what you put in it.
C- Tradition trumps new evidence
D- Organized alphabetically
Question 15

For the following questions, determine the ones that can be addressed by Science.

A- How old is the Earth?
B- What morphological characteristics were likely present in the common ancestor of humans and chimps?
C- Why was the Earth created?
D- How does coffee affect ulcers?
E- Are humans most closely related to chimpanzees?

Question 24

Identify each scenario as either a pre-zygotic or post-zygotic barrier to reproduction:

A- Populations never come into contact with each other
B- Offspring fail to reproduce
C- Male and female gametes fail to unite in fertilization.
D- Mating behaviors are not recognized by different organisms
E- Embryos are inviable and do not survive more than a few days
F- Genitalia structures are far too different to allow successful copulation

Question 25

Match the following species concept with one of its disadvantages.

A- Biological species concept
B- Phylogenetic species concept
C- Morphological species concept

Question 26

Which of the following are evidences that evolution has occurred (Mark all that apply): Choose at least one answer.
A- All of the different varieties of dogs that were artificially selected
B- Relatively young earth – less than 10 thousand years.
C- The fossil record
D- Adaptations acquired during life passed on to offspring
E- ack of homology among organisms
F- Marsupial radiation
G- All organisms share the same four DNA nucleotides (A T G C)
H- modern interpretation of the bible
I- Existence of vestigial organs
J- Humans evolving from modern day chimpanzee

Question 28

Mark all that apply: Which of the following is the equivalent to branching points on phylogenetic trees?

A- Speciation events
B- Nodes
C- Branches
D- Common ancestors
E- Internodes

Question 25

Which of the following best describes an enzyme?

A- They lower the amount of energy present in the substrate.
B- They lower the energy of activation of a reaction by binding the substrate.
C- They raise the energy of activation of a reaction by binding the substrate.
D- They heat up the reactants so that reactions occur at a greater speed.

Question 35

A pair of sex chromosomes found in a human male is most like

A- identical twins.
B- a pair of blue jeans.
C- a bride and groom.
D- a knife, fork, and spoon.

Question 46

What are the three main ingredients in photosynthesis?

A- Nitrogen
B- Carbon dioxide
C- Simple sugars
D- Oxygen
E- Light
F- ATP
G- Water

 

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

pathophysiology

 

BIO 1015 Week 4 Assignment 1 Discussion Question (***** Both Questions Answered + APA Format + Original Work + References ******)

 

 

Question 1

 

Alcohol Abuse

 

 

Mr. Wilko is a 40-year-old salesperson with a wife and three teenage children. He has recently begun to have a beer at lunch and a few drinks after work to reduce his work-related stress. An economic downturn in the housing industry has reduced the need for new home appliances and his income and sales record has been affected. Several other salespeople have been laid off at his firm. He has been told that if his sales and attendance records do not improve he will be fired. He and his wife are constantly arguing about finances and the children’s increasing demands for money. His drinking has increased to several beers at lunch and continued drinking after dinner. When he returns to work with alcohol on his breath, he is dismissed from his job. He continues to consume alcohol during the day as he attempts a job search. His wife is very concerned, as are his teenage children.

  • Mr. Wilko states he is a social drinker and “can stop at any time.” How accurate is his self-assessment? his self -assessment is not accurate for the simple fact that he considers himself a social drinker he is in denial that depression has set in.
  • What stressors are present in Mr. Wilko’s case? anxiety,depression
  • Why does Mr. Wilko continue to increase his alcohol intake? to surpress the feelings on depression or fear of losing his job he feels as if he continues to increase his drinking it will subside the feelings that he is having
  • What changes in liver function can Mr. Wilko expect if he continues to drink large amounts of alcohol? his liver function
  • Mr. Wilko complains to his wife that all the stress is causing “indigestion.” How do stress and alcohol consumption affect GI function?
  • Why is Mr. Wilko at greater risk of trauma? because he is consuming way too much alcohol at an increasing rate above normal which can lead to gastritis as well as pancreatitis

 

 

Question 2

 

Gastrointestinal Disorders Case

 

A 50-year-old man has been suffering from substernal pain for the last 5 months, particularly on waking up in the morning. He lost his job a year ago and was suffering from depression. He consumes about 12–16 cans of beer every day. He has lost his appetite too and says that eating aggravates pain.

  • Is this acute or chronic gastritis?  Chronic gastritis
  • What factors may lead to the development of gastritis? Loss of appetite black or tarry stools upset stomach depression
  • What investigation should be performed?
  • How can the patient be treated?

 

BIO 1015 Week 4

Week 4 assignments pathophysiology

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

: Value Proposition in Patient Care

HSA 501 ASSIGNMENT 1

Assignment 1: Value Proposition in Patient Care

Paradise Hospital, Inc. is a for-profit hospital. As the facility’s new hospital administrator, you have been tasked with improving the service value of the hospital. The administration has not done this process since the hospital began operating in the year 1995. The investors are not familiar with the value proposition strategies of hospitals in the current-day America.

Note: You may create and / or make all necessary assumptions needed for the completion of this assignment.

Write a four to six pages paper in which you:

1. Articulate the meaning of value-added service as it pertains to patient care services, and argue the major reasons why it matters to add value to patient services. Justify your response.

2. Outline a system for identifying the functional areas in which changes might be necessary in order to improve the hospital’s service value. Recommend the key methods that you would use to acquire the information necessary to identify the specified functional areas.

3. Specify four (4) specific areas where you believe the administration can add value in Paradise Hospital, and argue the most significant reasons why such value proposition would improve the value of services to the patients.

4. Use five (5) recent (within the last five [5] years) quality academic resources in this assignment. Note: Wikipedia and other websites do not qualify as quality academic resources.

NOTE: PLEASE USE AS A GUIDE OR REWRITE TO MAKE IT YOURS

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Cycle Ergometer and Step Submaximal Graded Exercise Tests

LAB 2​​

Demonstration of Cycle Ergometer and Step Submaximal Graded Exercise Tests

Purpose

This laboratory experience is designed to illustrate the pretesting, testing, and posttesting procedures for conducting a submaximal graded exercise test (GXT) on the cycle ergometer and step and to develop your skill in administering these tests.

Equipment

· Stationary cycle ergometer

· Step with risers

· HR monitor

· Sphygmomanometer

· Metronome

Student Assignments

1. Select one apparently healthy student to serve as the client.

2. Select one or two students to prep the client for the test.

3. Assign one student to monitor and collect HR data from HR monitor.

4. Select one student to measure palpated HRs.

5. Select one student to measure BPs.

6. Select one student to set and monitor work rates on cycle ergometer.

7. Select one student to monitor client throughout test and to obtain client’s RPE.

Testing Procedures

1. Select an appropriate cycle ergometer protocol for the client.

2. Prepare the client for the test, explain purpose and nature of the GXT, measure height and body weight, position electrodes, and calculate target HR for test termination if required by the GXT protocol.

3. Collect resting data. Measure resting HR using palpation and HR monitor. Measure resting BP using auscultatory method.

4. Collect exercise data. Measure exercise HR every minute using palpation and HR monitor. Measure exercise BP during last 2 min of each stage of test. Ask client for RPE during last minute of each stage of test. Closely monitor client throughout test, checking for signs and symptoms that indicate the test should be terminated. Make certain that client achieves a steady-state HR during the last 2 min of each stage (HR values within ±5 to 6 bpm) before increasing the work rate.

5. Continue GXT until test protocol is completed or target exercise HR is achieved, or HR, BP data indicate test should be stopped, or client voluntarily terminates the test.

6. Collect recovery data for 3 to 5 min. Measure recovery HR every minute using palpation and HR monitor. Measure recovery BP every 2 to 3 min.

Data Analysis

1. Use the HR and work rate data from the last two exercise stages to estimate the client’s VO2max using the multistage method. Hint: Use the ACSM cycle ergometry equation (see table 4.3) to calculate the metabolic cost for the last two exercise stages. Note: Use ACSM equation only if client obtained steady state (i.e., HRs during last 2 min of each stage are within ±5 to 6 bpm) for the last two stages of the GXT.

2. Graph the HR versus energy cost (ml · kg-1 · min-1) data for the last two stages. Estimate the client’s VO2max using the graphing method.

3. Determine the client’s cardiorespiratory fitness level by classifying the estimated VO2max (see table 4.1).

4. Graph the client’s HR response during each minute of exercise and recovery. Plot HR on the y-axis and time on the x-axis.

5. Extra credit: Correlate the client’s exercise HRs obtained from palpation and the HR monitor using the Pearson product-moment correlation technique (rx,y).

Data Collection Form for Cycle Ergometer and Step Submaximal Graded Exercise Test

Client’s Demographics

Name ____________________ Date _________
Age ___32__ yr Body weight _80___ kg
Height __174___ cm  

Resting Data

HR ____86__ bpm

BP ____125/80__ mmHg

GXT Test 1 Data: Astrand-Rhyming Cycle Ergometer Test

Protocol __________________

Target HR for test termination (if needed) ________ bpm

Minute Work rate HR palpated HR monitored RPE Systolic BP Diastolic BP
  kgm · min-1 Watt          
1       140   140 80
2       148   160 85
        152   165 80
4       156   160 80
5       160   160 75
6       160   140 80

Recovery Data HR Sys Dys

1         139 120 80
2         120 120 80
3         115 110 70
4              
5              

Reasons for stopping the test:

GXT Test 2 Data: Harvard Step Test

Protocol __________________

Target HR for test termination (if needed) ___188_____ bpm

Minute Work rate HR palpated HR monitored RPE Systolic BP Diastolic BP
  kgm · min-1 Watt          
1       162      
2       180      
3       189      
4       189      
5       191      
6              

Recovery Data

1              
2              
3              
4              
5              

Reasons for stopping the test:

Converting predicted VO2 max values from absolute (L/min) to relative (ml/kg/min).

mL/min = L/min *1000

mL/kg/min = mL/ body weight in kg

Ex. An 80 kg man achieved a peak VO2 of 4.7 L/min

4700 mL/min = 4.7 L/min *1000

58.75 mL/kg/min = 4700 mL/min/ 80kg

Lab report: Due October 15

This lab is a comparison between the submaximal step test and submaximal bike test. You will be comparing your data and evaluating results from each test.

5 From V. Heyward and A. Gibson. 2014, Advanced Fitness Assessment and Exercise Prescription instructor guide, 7th ed. (Champaign, IL: Human Kinetics).
 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"