Create a brochure about human society’s impact on ecosystems

1.Create a brochure about human society’s impact on ecosystems and the costs and benefits of human enterprise. Include the following:

  • Explain how ecosystem degradation and loss results from human society.
  • Describe the effects of human activity on plants, animals, and ecosystem dynamics, and provide specific examples.
  • Describe the economic decisions underlying conservation and exploitation. Explain the costs and benefits of human enterprise in terms of ecosystems, and provide specific examples.

Use images as appropriate.

Cite at least two references consistent with APA guidelines.

 

Use fist two attachement for this

 

 

2. write a 1,050- to 1,400-word paper about the ecosystems you have chosen and the species that make up these ecosystems. In your paper, include the following items:

  • Describe your pair of ecosystems and the types of current or proposed exploitation in one or both ecosystems. Explain the past, present, and potential future consequences of overexploitation in these ecosystems. Describe the potential costs and benefits of at least two exploitation activities.
  • Explain current and potential management of your ecosystems. How can modification, cultivation, or restoration alter these ecosystems? Outline at least two potential management plans beyond cessation of exploitation, and describe the costs and benefits of each.
  • Prioritize conservation efforts in your pair of ecosystems based on values and the principles of conservation biology by including the following elements:
    • Prioritize species and ecosystems for protection based on the values identified in the Acting Locally Paper – Part One.
    • Describe a regional or global threat to your ecosystems, such as global climate change, and outline a plan to combat this threat.
    • Rank the priorities of continuing or ceasing exploitation activities, of alternative management plans, and of the plan to combat the regional or global threat to biodiversity.
    • Defend your prioritization based on specific values and on your plan’s overall effect on biodiversity, ecological integrity, and economic feasibility.
  • Identify at least two specific practical actions and at least two specific political actions you can take to support the top priorities you have identified for the pair of ecosystems. Interpret how these specific actions can support conservation and biodiversity.

Cite at least four references.

Format your paper consistent with APA guidelines.

 

uSE the 3rd attachment for possible reference

 

 

 

3.Write a 1,050- to 1,400-word paper about genetically vigorous populations. Include the following items:

  • Describe the importance of genetic diversity in populations. Explain how genetic diversity in plants and animals supports long-term viability, biodiversity, and biotic integrity. Describe specific examples of at least one plant population and at least one animal population facing challenges in genetic diversity, and explain the potential or demonstrated threats to viability posed by deficient genetic diversity.
  • Describe the values underlying population management. Relate genetic diversity to the success of population management. Explain the costs and benefits in successful population management. Provide at least two specific examples of current and past population management efforts.
  • Compare ex situ conservation to in situ conservation. Describe the role of zoos, aquariums, and botanical gardens in conservation. Explain the efforts of these institutions to support genetically vigorous populations.
  • Explain why the Endangered Species Act was created to promote conservation of plants and animals.

Cite at least six references, including at least two scholarly sources.

Format your paper consistent with APA guidelines.

e eBook Collection chapter 8

With light streaming out of our cities at night, with roads and power lines etched

across most landscapes, any visitor from another planet would be well aware of

human activities long before arriving on earth. A conservation biologist might argue

that Homo sapiens is only one of many millions of species that constitute life on earth,

but there is no denying that people are a dominant life-form. As we have captured

more and more of the earth’s resources, allowing our population and biomass to

grow larger and larger, many other species have declined or even disappeared. Indeed,

you could build a strong argument that we have degraded the overall ability of the

earth to support life given the area occupied by human activity and the amount of

photosynthesis appropriated by people (Vitousek et al. 1997; Rojstaczer et al. 2001;

Sanderson et al. 2002a; Haberl et al. 2004; Imhoff et al. 2004) (Fig. 8.1).

In this chapter we will examine the various ways in which people diminish the

earth’s ability to support a diverse biota. To begin, we need to make some key distinctions,

starting with habitat versus ecosystem. A habitat is the physical and biological

environment used by an individual, a population, a species, or perhaps a group of

species (Hall et al. 1997). In other words, at the species level we can speak of blue

whale habitat and sequoia habitat, and perhaps waterfowl habitat. However, if the

group of species is too broad, the term becomes so general as to be almost meaningless.

What does “wild life habitat” mean if virtually every environment supports wild

organisms? Even a parking lot will have microbes and small invertebrates living in the

cracks in the pavement. An ecosystem is a group of organisms and their physical

environment (see Chapter 4), such as a lake or a forest, and it may or may not correspond

to the habitat of a species. A forest ecosystem may constitute the sole habitat of

a squirrel, but a frog’s habitat might include both the forest and a lake, and a bark

beetle’s habitat might only be certain species of trees spread widely across the forest.

We can also make a distinction between degradation and loss of habitats or ecosystems.

Habitat degradation is the process by which habitat quality for a given species is

diminished: for example, when contaminants reduce a species’s ability to reproduce in

an area. When habitat quality is so low that the environment is no longer usable by a

given species, then habitat loss has occurred. The line between habitat degradation

and loss will often be unclear. For example, if environmental changes prevent a

species from reproducing, but some individuals can still be found (e.g. dispersing juvenile

animals, or a few old trees that survive, but whose seeds never survive), is this

habitat loss or severe degradation? Sometimes, these differences can be clarified if we

describe the types of habitat use more explicitly: for example, by referring to breeding

CHAPTER 8

Ecosystem

Degradation and Loss

Ecosystem Degradation and Loss 151

habitat, foraging habitat, winter habitat, and so on. Note that habitat loss or degradation

for one species will probably constitute habitat gain or enhancement for some

other species. For example, cutting a forest is likely to degrade or destroy habitat for a

squirrel, but the resulting early successional ecosystem is likely to be new habitat for

at least one butterfly species. A more poignant example comes from the Everglades,

where managing the hydrological regime means choosing between the habitat of two

endangered species: wood storks (which need periods of very limited water to concentrate

their food in residual pools) and snail kites (which need long, wet periods)

(Bancroft et al. 1992; Beissinger 1995; Curnutt et al. 2000).

Ecosystem degradation occurs when alterations to an ecosystem degrade or destroy

habitat for many of the species that constitute the ecosystem. For example, when

warm water from a power plant increases the temperature of a river, causing many

temperature-sensitive species to disappear, this is ecosystem degradation by a conservation

biologist’s definition. In contrast, an ecosystem ecologist might focus on

changes in ecosystem function such as a reduction in productivity, rather than on

structural attributes such as the abundance and diversity of biota. Ecosystem loss

occurs when the changes to an ecosystem are so profound and when so many

species, particularly those that dominate the ecosystem, are lost that the ecosystem

is converted to another type. Deforestation and draining wetlands are just two of

many processes that destroy ecosystems.

Let us consider a hypothetical example to illustrate these distinctions. Imagine a

small forest park on the edge of city in which there are many dead and dying trees

Figure 8.1 This map shows the human footprint, a quantitative depiction of human influence on the land surface,

based on geographic data on human population density, land transformation, transportation and electrical power

infrastructure, and normalized to reflect the continuum of human influence across each terrestrial biome defined

within biogeographic realms. Further details are available at the “Atlas of the Human Footprint” website

(www.wcs.org/humanfootprint) and in Sanderson et al. (2002a). (Map provided by the Wildlife Conservation Society.)

(i.e. snags). The park manager might decide to make this forest safer for walkers by

removing all snags near paths. This would degrade the park’s value as a habitat for

the many species that require snags, such as woodpeckers and termites. If the manager

were very thorough and cut down every snag in the park, regardless of its location,

this would constitute habitat loss for snag-dependent species. Assuming

snag-associated species were more than a trivial portion of the forest’s biota, then loss

of snags would also lead to ecosystem degradation. Removing the forest to create a

golf course would constitute ecosystem loss.

There are many ways to degrade or destroy habitats or ecosystems, and in this chapter

we can only provide a broad overview. We will begin with two sections on what

humans add to natural environments: (1) substances that contaminate air, water, soil,

and biota; and (2) physical structures such as roads, dams, and buildings. The third section

covers some of the ways we modify physical environments by eroding soil, consuming

water, and changing fire regimes. In the fourth, fifth, and sixth sections we will

review three major processes by which ecosystems are destroyed or severely degraded:

deforestation, desertification, and the various processes afflicting wetlands and aquatic

ecosystems (e.g. draining and filling). We will not focus on two of the major causes of

ecosystem loss and species endangerment: conversion of ecosystems to urban areas and

agriculture (Czech et al. 2000; McKinney 2002). Their direct effects are so unsubtle

that they do not require much elaboration; we will discuss how to mitigate their impacts

in Chapter 12, “Managing Ecosystems.” Finally, we will discuss fragmentation, a process

by which ecosystem destruction can isolate the biota of those ecosystems that remain

intact. For the sake of simplicity we will cover each issue independently, but realize that

in the real world many problems occur simultaneously and interact with one another.

Two special forms of ecosystem degradation – overexploitation of biota and introduction

of exotic species – will be covered in Chapters 9 and 10, “Overexploitation” and

“Invasive Exotics.” Note that all these sundry threats are direct, proximate causes of loss

of biodiversity. As with so many problems, the ultimate cause is human overpopulation

and overconsumption, but we will reserve discussion of this topic until Part IV, “The

Human Factors.” One deadly enterprise merits special mention here: war. The human

dimensions of war’s tragedies are all too familiar, and it takes but a moment’s reflection

to extend its images – ravaged lands, shattered bodies – to all biota. As you read the following

chapter, realize that virtually all the activities described here can become part of

a war machine with dire and far-reaching consequences (Westing 1980; Dudley et al.

2002). Indeed, long after a war is over, elephants, rhinos, and any large, marketable

animals will continue to suffer from the widespread distribution of weaponry.

Contamination

One might define a pollutant or contaminant as a substance that is where we do not

want it to be. This suggests that substances often do not stay where we put them; they

move. There are three main media that can move pollutants – air, water, and living

organisms – and we will structure our overview of the topic by focusing on air pollution,

water pollution, and pesticides. Note that there is overlap among these media; for

example, acid rain begins as air pollutants and ends up contaminating a lake or causing

increased concentrations of heavy metals in biota. Pesticides can be distributed by air or

water, but we will focus on those that move from organism to organism in a food web.

152 Part II Threats to Biodiversity

Air Pollution

Every day huge quantities of materials are lofted into the atmosphere from our vehicles,

factories, and homes. Nitrogen oxides and sulfur oxides combine with water to

form nitric and sulfuric acids, the basis of acid rain. Chlorofluorocarbons (CFCs) and

halons rise to the upper atmosphere, where they reduce the concentration of ozone,

allowing more harmful ultraviolet radiation to reach the earth’s surface. Closer to

earth, ozone and a suite of other chemicals form toxic clouds called smog.

Through extensive research we know that these and other forms of air pollution

have impaired the health of people and domestic plants and animals (Holgate et al.

1999). We know less about the effects of air pollution on wild species, but given the

basic similarity in the physiology of domestic and wild species, it is likely that they are

also affected (Barker and Tingey 1992). Certainly severe air pollution has even killed

the majority of plant species downwind from some factories (Fig. 8.2). No doubt

many animal species also become locally extinct in these zones, but it would be hard

to know if they were directly eliminated by air pollution or simply disappeared

because of the loss of plant species. Even moderate levels of air pollution are known

to eradicate many lichen species; in fact this relationship is so well documented that

lichens are widely used to monitor air pollution (Gombert et al. 2005).

Chronic effects that diminish an individual’s health and vigor, and thereby reduce

reproductive success or longevity, are probably more common than acute effects that kill

organisms directly. For example, in parts of Belgium great tits have reduced reproductive

success that appears to be correlated to heavy metal contamination (Janssens et al. 2003).

Ecosystem Degradation and Loss 153

Figure 8.2 Fumes from a copper smelter killed most of the vegetation in the Copper

Basin, Tennessee. This photo was taken in 1945, about 25 years after the fumes were

controlled. (Photo from USDA Forest Service.)

154 Part II Threats to Biodiversity

Even species living far from the source of air pollution may be affected. Notably,

declines in some remote amphibian populations (Houlahan et al. 2000; Beebee and

Griffiths 2005) might be linked to air pollution because of its effects on the acidity of

aquatic ecosystems, global climate, pesticides, and ultraviolet radiation. For example,

some research indicates that certain amphibian species, especially those living at high

altitudes, are vulnerable to ultraviolet-B radiation (e.g. Blaustein et al. 2003); at least

one paper has directly implicated climate change in the loss of many frog species at a

Costa Rican site (Pounds et al. 1999; see Chapter 6); and Fig. 8.3 presents a case where

pesticides carried by the wind were implicated. Similarly, one of the major threats to

coral reefs can probably be traced to global climate change induced by air pollution;

Figure 8.3

Analysis of the

spatial patterns of

dominant winds

(arrows) and agricultural

lands

(shaded areas) indicated

that air pollution

by pesticides

is likely to have

played a major role

in the decline of

four species of

frogs in California

(Davidson et al.

2002). Two other

species seemed to

have been more

affected by direct

habitat loss; climate

change and

ultraviolet radiation

did not seem

important in this

system.

unusually warm water temperatures are thought to be a primary cause of “bleaching,”

the massive death of coral polyps (West and Salm 2003).

Water Pollution

The list of substances with which we pollute aquatic ecosystems is very diverse. It

includes innocuous materials such as mud and plant matter that may become

contaminants only when they reach such high concentrations that they smother the

bottom of aquatic ecosystems or use up all the oxygen as they decompose. The list

also includes chemicals such as nitrates and phosphates that are important nutrients

for aquatic plants, but can lead to an excessive growth of plants, upsetting the balance

of an aquatic ecosystem. On the other hand, there are chemicals such as dioxin

that endanger life at concentrations so low that they are measured in parts per billion.

Some pollutants are routinely discharged into aquatic ecosystems from factories and

sewage treatment plants. Others enter in a catastrophic deluge after an accident such

as the rupture of an oil tanker. Still others, such as sediments, pesticides, and fertilizers,

often seep in gradually, carried by the runoff from our agricultural fields, lawns,

and streets. When pollutants originate from broad areas, these places are called nonpoint

sources, in contrast to specific sites (e.g. factories), which are called point sources.

It may surprise you to know that nonpoint-source pollution, usually involving

sediments and nutrients and not highly toxic chemicals, is considered the leading

threat to endangered freshwater species in the United States (Richter et al. 1997).

Not surprisingly, aquatic species and ecosystems are more threatened by water pollution

than are terrestrial biota. On a local scale, there are many lakes, streams,

rivers, and bays where water pollution has eliminated so many species that it would

be fair to say that the aquatic ecosystem has been destroyed, even though a body of

water and a handful of species remain. One of Europe’s largest rivers, the Rhine,

exemplifies this problem; along substantial stretches the natural biota has been

severely altered by pollution (Table 8.1) (Broseliske et al. 1991).

Elimination of a species from a single water body may mean global extinction

because many aquatic species are found in a single lake or river system, having

evolved in isolation from their relatives in nearby water bodies. One of the most interesting

examples of this comes from Lake Victoria in East Africa, home to hundreds of

endemic cichlid fish species (Seehausen et al. 1997). Separation among these closely

related species is highly dependent on females choosing mates of the correct species;

however, with growing eutrophication the lake’s turbidity is increasing, and the

females cannot distinguish the colors they need to see to choose the correct mates.

Consequently, cichlid diversity is declining in eutrophic areas of the lake.

In contrast, water pollution is less likely to cause global extinction of species in

marine ecosystems than in freshwater ecosystems because marine ecosystems are

often too large to pollute in their entirety and because many marine species have large

geographic ranges, making it less likely that their entire range would be so polluted as

to be uninhabitable (Palumbi and Hedgecock 2005). Even though water pollution

may not be responsible for the global extinction of marine species, it still can have a

profound impact on marine biodiversity, particularly through local extirpations: for

example, when coral reefs are smothered in silt or overrun with macroalgae because

of excessive nutrients and eutrophication (Jompa and McCook 2003; Nugues and

Roberts 2003). Water pollution can also upset the equilibrium of marine food webs,

Ecosystem Degradation and Loss 155

such as when an excess of nutrients causes an explosive growth of toxin-producing

plankton known as “harmful algal blooms” (Anderson et al. 2002).

In recent years growing concern has focused on contamination from pharmaceutical

drugs such as ibuprofen and other anti-inflammatory analgesics that pass from

humans into aquatic ecosystems through waste water disposal (Tixier et al. 2003).

In one case a drug administered to cattle, diflonac, has caused kidney failure in three

species of vultures that feed on cattle carcasses, leading to widespread, catastrophic

declines in vulture populations in the Indian subcontinent (Oaks et al. 2004).

Pesticides

To capture a large portion of the earth’s resources people must compete against other

organisms, and pesticides are one of our preferred tools for doing this. We use enormous

quantities of insecticides and rodenticides to kill animals that would eat our

crops, herbicides to kill plants that would compete with our crop plants, and fungicides

to kill fungi that would decompose our food and fiber. Worldwide, over 50,000 different

pesticide products with active ingredients weighing over 2.6 million metric tons are

used each year (World Resources Institute et al. 1998). Some of these pesticides are

relatively benign. They kill only a small group of target organisms, they are used in

limited areas (e.g. food storage facilities), and after use they quickly break down into

harmless chemicals. Unfortunately, very few pesticides meet all these criteria, and

some, such as the notorious DDT, wreak havoc on a broad set of nontarget organisms

for a long period over large areas.

156 Part II Threats to Biodiversity

Upper Rhine Middle Rhine Lower Rhine

1916 1980 1916 1980 ~1900 1981–1987

Gastropoda (snails) 8 4 8 5 11 10

Lamellibranchiata (mussels) 11 4 10 4 14 7

Crustacea (crustaceans) 3 2 3 2 3 13

Heteroptera (true bugs) 2 1 1 0 1 1

Odonata (dragonflies) 2 1 1 0 3 2

Ephemeroptera (mayflies) 11 4 3 0 21 2

Plecoptera (stoneflies) 13 0 12 0 13 0

Trichoptera (caddisflies) 11 5 11 2 17 5

Total 61 21 49 13 83 40

Source: from Broseliske et al. (1991).

Table 8.1

Changes in species

richness of some

invertebrate taxa in

the Rhine.

Ecosystem Degradation and Loss 157

Croplands strewn with corpses can

mark the aftermath of pesticide use, but

more often the effects are not seen until

much later and in more subtle ways. One

example of this has garnered considerable

attention: pesticides and related chemicals

that mimic the action of the female

sex hormone estradiol (Colborn et al.

1996; National Research Council 1999;

Hayes 2004). Sterility, delayed sexual

maturity, abnormal sex organs, and an

array of other problems have been attributed

to these contaminants, which are

characterized as “endocrine disruptors”

or “hormonally active agents.” Longterm,

insidious effects of pesticides are

well documented because some of them

can persist in the tissue of living organisms,

accumulating in one individual, and

passing on to other individuals through a

food web. The most infamous example

involves a set of chemicals known as

chlorinated hydrocarbons (which

includes DDT, many other pesticides, and

some chemicals that are not pesticides,

such as PCBs, polychlorinated biphenyls).

They are soluble in fat and can take years,

even decades, to break down. This means

that they pass from prey to predators up a

food chain and can concentrate in top

predators, a process known as biomagnification

(Fig. 8.4). Populations of several

predatory birds (ospreys, brown pelicans,

bald eagles, peregrines, and others) were

dramatically reduced by chlorinated

hydrocarbons during the 1950s and

1960s. Use of these chemicals has been

sharply curtailed in many wealthier countries, and this has allowed populations of these

birds to recover somewhat (Sheail 1985). However, use of chlorinated hydrocarbon pesticides

continues in many less-developed countries, and, because of their persistence, a

wide variety of chlorinated hydrocarbons continue to contaminate the environment of

places where they have been banned (Berg et al. 1992; Gonzalez-Farias et al. 2002).

Accounts of the negative effects of pesticides typically focus on species that are most

similar to us – birds and mammals – because we tend to be more concerned about their

welfare, and because toxic effects on these species may portend toxic effects on us.

However, it is likely that the most serious effects of pesticides fall on organisms that are

most closely related to the target species. Consider the insect order Lepidoptera (butterflies

Figure 8.4 Persistent pesticides and similar compounds accumulate

in the tissues of one species and then are passed up the food

web to other species where they become more concentrated. This

process is called biomagnification or bioamplification. In this figure

DDT has entered the food web of Lake Kariba in Zimbabwe and

reached its highest levels in top predators such as crocodiles, tigerfish,

and cormorants. Numbers are parts per billion of DDT and its

derivatives in the fat of the species illustrated. (Redrawn by permission

from Berg et al. 1992.)

and moths), which includes many pest species, as well as many endangered species. It

seems reasonable to assume that attempts to control pest lepidoptera with insecticides

would jeopardize some rare lepidoptera, although in practice this has not been well documented

to date (New 1997; Pimentel and Raven 2000). Loss of nontarget insect populations

may have far-reaching consequences. In particular, there is growing concern about

the loss of pollinating insects and the consequences this may have for a wide range of

plants that require animal pollinators, for the other animals dependent on those plants,

and for human food production (Allen-Wardell et al. 1998; Kremen et al. 2002).

Roads, Dams, and Other Structures

Flying in a plane, you can easily see the hand of humanity; most landscapes are crisscrossed

with roads, railroads, fences, and utility corridors and dotted with buildings,

dams, mines, parking lots, and many other structures. The total area covered by such

structures is significant (about 3 million km2 worldwide; over 2% of the land area

[Wackernagel et al. 2002]) and represents a loss of habitat for virtually all wild species.

Looking beyond the immediate footprint of these structures,

one can see that a much larger area is affected. For example,

roads and their adjacent impact zones cover an estimated

20% of the area of the United States (Forman 2000; also

see Riitters and Wickham 2003). Thus we can list “construction

of human infrastructure” along with deforestation,

desertification, and other processes that destroy entire

ecosystems, all of which we will discuss later in this chapter.

In this section we will focus on the consequences of adding

these and other structures to the biota of entire landscapes,

especially on animals that move across landscapes.

Roads

The most ubiquitous structures created by people are roads,

and while roads facilitate the movement of people, they can

also serve as impediments to the movements of many animals

(Forman and Alexander 1998; Forman et al. 2003).

Some roads have curbs or lane dividers that are an absolute

barrier to small, flightless animals such as amphibians, small

reptiles, and various invertebrates. More commonly animals

are capable of crossing a road, but may be run down in the

process (Fig. 8.5). In a two-year study of a 3.6 km stretch of

highway in Ontario, Canada, over 32,000 vertebrate carcasses

were found (Ashley and Robinson 1996). Most of the

mortality fell on amphibians and reptiles; overland migrations

of these species to and from breeding sites make them

especially vulnerable (e.g. Gibbs and Shriver 2002; Gibbs

and Steen 2005). Nevertheless, just the mortality of birds

(62 species; 1302 individuals) and mammals (21 species;

282 individuals) in this study would extrapolate to billions of

carcasses on the world’s road system without even

158 Part II Threats to Biodiversity

Figure 8.5 Roads act as filters to the movements

of many animals, especially because of

collisions such as the one that killed this tayra in

Belize. (Photo from M. Hunter.)

attempting to measure the mortality of amphibians, reptiles, and invertebrates. Most of

the individual animals killed on roads may be of common species that are in no danger of

extinction, but even a few road deaths can be of great consequence for an endangered

species. For example, Florida scrub jay territories adjacent to roads are population sinks

because of traffic-induced mortality (Mumme et al. 2000). For some species roads are a

psychological filter; individuals are apparently reluctant to cross them even though physically

capable of doing so. In the Brazilian Amazon some bird species, especially those

found in the understory of interior forests, very rarely crossed roads, even roads where

regrowth formed a nearly intact canopy over the road (Laurance et al. 2004). If organisms

are unable or unwilling to cross a road, then the populations on either side of the

road may become isolated from one another; this has been demonstrated for amphibians

(Gibbs 1998) and beetles (Keller and Largiader 2003).

A second major problem associated with roads is the access they provide to people

who may overexploit organisms or destroy whole ecosystems. The roads penetrating

formerly remote areas of tropical forest, allowing access by poachers who overexploit

game populations and settlers who raze the tropical forests, are a particularly lamentable

example of this phenomenon. The effect of road access on habitat quality has

been well studied for some large carnivores such as wolves and tigers (Kerley et al.

2002; Theuerkauf et al. 2003).

Roads may also provide access to exotic organisms that can disrupt native populations

(Hansen and Clevenger 2005). Usually, these will be species carried, intentionally

or not, by people traveling along the highway. Sometimes, exotic species will move

along the road by themselves. In particular, weedy exotic plants seem to use the

disturbed ground of roadsides to invade a landscape (Gelbard and Belnap 2003)

(Fig. 8.6). Finally, roads have a variety of physical and chemical attributes that are

likely to affect adjacent aquatic and terrestrial ecosystems. These include various substances

such as dust, sediment, salt, heavy metals, hydrocarbons; a sunny, windy,

warm microclimate; blocking surface water runoff; and more (Trombulak and Frissell

2000; Angermeier et al. 2004). One of the most annoying physical aspects of roads for

human observers – traffic noise – was found to reduce bird population densities in a

band hundreds of meters wide in one study (Reijnen et al. 1995).

Dams

Worldwide, over 45,000 large dams (>15 meters high) have affected most of the

world’s major river systems (Nilsson et al. 2005). The damming of streams and rivers

destroys many aquatic ecosystems, flooding ecosystems upstream of the dam and

changing water flows to downstream ecosystems. We will return to these issues in a

later section; here the focus will be on the barrier effects of dams. Many animals move

up and down rivers during the course of a year, or during their life cycle, searching for

the best places to forage or breed. Some of them can fly or walk around dams (otters,

mergansers, mayflies, etc.), but for totally aquatic species dams can be very significant

barriers. Moving downstream these animals are likely to be churned to death or at

least highly stressed in turbines (Wertheimer and Evans 2005). Moving upstream

they encounter an insurmountable wall that may or may not have a fish ladder

around it, and even fish ladders work for only a portion of the population. The reservoir

behind a dam may also impede movement, especially if it has been stocked with

exotic, predatory fish. Of course, fish are the best known victims of dams, especially

Ecosystem Degradation and Loss 159

anadromous fish such as salmon that move long distances between riverine spawning

areas and marine foraging areas (Petrosky et al. 2001; Fig. 8.7). Some salmon populations

have been completely eliminated, largely by dams, despite millions of dollars

spent building fishways, trucking fish around dams, supplementing populations with

hatchery-reared stocks, and so on (Molony et al. 2003). A study of eight rivers in

Sweden suggested that the effects of dams and reservoirs on shoreline plants are also

shaped by dispersal issues: water-dispersed species with a limited ability to float were

strongly affected by damming (Jansson et al. 2000a; also see 2000b).

Other Barriers

Some landscapes are dissected by barriers specifically designed to inhibit the movement

of animals. Notably, rangeland fences stretch huge distances, controlling the

movement of both livestock and large wild mammals and sometimes severing

seasonal migrations (Berger 2004). For example, in Botswana, thousands of kilometers

of fences have been erected to isolate livestock from wild ungulates that might

harbor diseases. These fences have had catastrophic consequences for native ungulates,

especially wildebeest, that must migrate to access water during dry seasons

(Williamson et al. 1988).

160 Part II Threats to Biodiversity

Figure 8.6 Exotic and native plant species richness in plots 50 meters away from paved,

improved-surface, graded, and four-wheel-drive (4WD) roads through grasslands, shrublands,

and woodlands in southern Utah, USA (Gelbard and Belnap 2003). Error bars represent

1 SE. Different letters indicate significant differences (p < 0.05) among levels of road

improvement.

Utility corridors also dissect landscapes, potentially isolating the organisms on

either side. For example, a forest herb that spreads by means of vegetative reproduction

would be impeded by the dry, sunny environment of a power line running

through a forest. In one study even reindeer, a species usually found in open environments,

exhibited avoidance of power lines during winters in Norway (Nellemann et al.

2001). Pipelines and irrigation canals also have the potential to be direct barriers. In

the best known example of this issue – the Trans-Alaskan Pipeline and caribou

migrations – elevating the pipe kept it from being an absolute barrier but pipelines

still degrade caribou habitat quality (Cameron et al. 2005).

Most bird species can readily fly over human-made barriers, although some forest

birds are very reluctant to venture into the open, and some of the large, flightless birds

(e.g. emus and ostriches) are easily stopped by fences. Unfortunately, birds are often

killed by flying into human structures. Large numbers of migrating birds collide with

power lines, antennas, lighthouses, windmills, and similar structures (e.g. Barrios and

Rodriguez 2004); even local movements can result in a collision with a large window.

Trash and Other Things

In this final section on human-made structures we will list some of the other things

people make and then add to the natural environment that are detrimental to other

Ecosystem Degradation and Loss 161

Figure 8.7 Survival of wild, juvenile, chinook salmon migrating toward the sea before

(1966–8) and after (1970–5) completion of two dams on the Snake River in Washington.

(Redrawn by permission from Raymond 1979; also see Petrosky et al. 2001.)

organisms. Much of this material is trash, things discarded by people, perhaps intentionally

or perhaps not. Lost or discarded fishing gear is a major hazard (Coe and Rogers

1997; Derraik 2002). The worst offenders are probably lost gill nets – often called ghost

nets – which can drift for months or years, still catching fish, diving birds, seals, and

other creatures. It is difficult to estimate the extent of this mortality, but with about

21,300 km of nets (enough to reach more than halfway around the world) set nightly

to catch salmon and squid in the North Pacific alone, the total loss is likely to be enormous

(Laist 1987). Even a single strand of monofilament fishing line discarded by an

angler can ensnare an animal and kill it. Fishing sinkers made of lead and lead shot discharged

by waterfowl hunters accumulate on the bottoms of water bodies, where they

are likely to be swallowed by bottom-feeding birds and cause lead poisoning (Sanderson

and Bellrose 1986; Sidor et al. 2003). Lead shot in carcasses often poisons scavengers

such as California condors and various species of eagles (Pain et al. 2005). One of the

major causes of death among sea turtles appears to be ingesting marine debris, especially

plastic bags and balloons that they mistake for jellyfish (Derraik 2002).

Some of the problems we cause by putting human-made objects into natural environments

would be hard to predict. Consider a seemingly innocuous item, red plastic

insulators for electric fences. It turns out that large numbers of hummingbirds mistook

the insulators for flowers and electrocuted themselves until the manufacturer

withdrew the product. Street lights on beaches may make people feel safer, but they

can disorient hatchling sea turtles when they emerge from their nests and make an

already perilous trip to the sea even more dangerous (Tuxbury and Salmon 2005).

Given that six of the seven species of marine turtle are endangered to varying

degrees, any added source of mortality may be of some consequence.

Lastly, we can list the forms of motorized transport that travel across our lands and

waters without using roads, often crushing plants, colliding with animals, and compacting

and eroding soil. Collisions with motor boats are a major source of mortality for

manatees in Florida (Nowacek et al. 2004). In deserts and on beaches off-road vehicles

are a threat to sedentary or slow-moving species such as plants, hatchling birds, and

desert tortoises. Ironically, fences are a common way to control off-road vehicles (Brooks

1995, 1999), and these have their own ecological problems unless carefully designed.

Earth, Fire, Water

In this section we will consider some of the ways people modify physical environments

that may have negative consequences for biota. We will focus on three issues –

soil erosion, changing fire regimes, and water consumption – that usually degrade

ecosystems without destroying them.

Soil Erosion

Soil erosion is a natural process, an inevitable consequence of wind, rain, and gravity.

The problem is that the rate of soil erosion is often greatly accelerated by human use of

ecosystems (Fig. 8.8). Indeed, it has been estimated that collectively human activities,

such as agriculture, overgrazing by livestock, timber harvesting, and road and building

construction, erode soil at ten times the rate of all natural processes combined

(Wilkinson 2005). Under extreme circumstances, soils that took centuries to form can

be eroded in a matter of hours in a torrential rain storm.

162 Part II Threats to Biodiversity

Ecosystem Degradation and Loss 163

Soil erosion is a double-edged sword. Not only does it

produce sediments that can blanket other ecosystems,

leading to some of the water pollution problems discussed

above (Alin et al. 1999), but it also degrades the productivity

of the land from which the soil is eroded. As Lester

Brown has written, “Society can survive the exhaustion of

oil reserves, but not the continuing wholesale loss of topsoil.”

When a terrestrial ecosystem loses soil and its productivity

is diminished, what are the consequences for the

ecosystem’s biota? This is a difficult question, in part

because there is no simple relationship between productivity

and biodiversity. Some highly productive ecosystems

support a very diverse biota (e.g. tropical rain forests), and

some support relatively few species (e.g. salt marshes). In

the short term, most species are likely to be more affected

by the agent of soil disturbance – the plow, the chainsaw,

etc. – than by the subsequent soil erosion. In the long

term, diminishing the productivity of an ecosystem for

several centuries could be one more stressor that pushes a

species that is dependent on that type of ecosystem a bit

closer to extinction.

In some severe cases, ecosystems can be highly

degraded and species extirpated by soil erosion. For example,

on Round Island in the Indian Ocean, rabbits and

goats introduced to provide a food source for passing

mariners removed most of the vegetation and this led to

severe soil erosion. Two species of reptiles became extinct,

and ten species of plants, three reptiles, and a seabird

were at risk until the exotic herbivores were removed and

erosion was brought under control (North et al. 1994).

We will return to soil erosion below in our discussion on

desertification.

Fire Regimes

Few phenomena can match the ability of a large, hot forest fire to totally transform a

natural ecosystem in a short time. Volcanoes, nuclear bombs, and large meteorites

could readily match a fire, but, thankfully, these are rare events. The apparent devastation

wrought by severe fires has led to concerted efforts to control all fires. Smokey

the Bear’s “Only you can prevent forest fires!” is one of the best-known phrases in the

United States’ advertising media.

Unfortunately, the campaign has been too successful in many respects, especially

when humans reduce the frequency of fires in ecosystems where they are a natural

phenomenon (Van Lear et al. 2005). For example, most natural grasslands and shrublands,

and some types of forests (e.g. certain eucalypt forests in Australia and pine

forests of the southeastern and southwestern United States) are adapted to experiencing

low-intensity fires at frequent intervals (Whelan 1995; Bond and Keeley 2005;

Bond et al. 2005). Consequently, their vegetation changes dramatically without fires to

Figure 8.8 Soil erosion has profoundly degraded

ecosystem productivity in many regions, although it

is most noticeable in mountainous areas, as in this

photo from the Himalayas. (Photo from M. Hunter.)

inhibit the influx of fire-intolerant species. Furthermore, when low-intensity fires are

suppressed, fuel can accumulate and any fire that does get started is likely to be very

intensive. A well known example of the consequences of removing fire from a firedependent

ecosystem comes from Michigan, where fire suppression led to a shortage of

young jack pine stands, the sole habitat of the rare Kirtland’s warbler (Probst and

Donnerwright 2003). The Kirtland’s warbler almost became extinct before its habitat

needs were recognized and met through active forest management.

On the other hand, humans often burn ecosystems quite deliberately. This can be an

ecological problem if the frequency and intensity of the fires are too great. For example,

about 70% of the forests of New Zealand have been eliminated by fire; much of

this occurred soon after Polynesian colonization (Ogden et al. 1998). Undoubtedly,

the very earliest humans realized that fire often promotes grassy vegetation, and

therefore they set fires to produce food for their preferred prey animals and later for

their livestock. These practices continue in many places to this day and, when overdone,

can be a problem. This is most evident when fire is used as a tool to clear forest

for agriculture, as is happening in many countries with burgeoning human populations,

an issue we will discuss below. It might also be a problem in semiarid environments

where frequent burning allows little opportunity for the soil’s organic matter to

develop and thus can contribute to desertification (Woube 1998; Savory and

Butterfield 1999).

Water Use

Every year people directly use 4430 cubic kilometers of water (Postel et al. 1996): that

is over 700,000 liters per person. Some of it we drink. Far more of it we use to irrigate

our crops and lawns, to bathe, to flush our toilets, to manufacture sundry products

such as paper, and to cool our power plants. To be specific, an estimated 65% is used for

agriculture, 22% for industry, and 7% for domestic purposes, and 6% is lost to evaporation

from reservoirs (Postel et al. 1996). With 43,000 liters required to produce a kilogram

of beef it is not surprising that agriculture is the dominant use (Pimentel et al.

2004). Some of this water is returned to an aquatic ecosystem; most of it is returned to

the atmosphere through evaporation and transpiration. When large volumes of water

are removed from aquatic ecosystems, their biota is likely to be affected. Not surprisingly,

the effects are most dramatic in arid regions. Desert springs, streams, and wetlands

are usually rare and fragile ecosystems, often containing unique species that

have evolved in isolation (Minckley and Deacon 1991; Fagan et al. 2002). Obviously, if

most of their water is removed, these ecosystems will be degraded (Contreras-B. and

Lozano-V. 1994). Consider the lower Colorado River in the arid southwestern United

States, where water flow disruptions have had a major role in the decline of 45 endangered

species (Glenn et al. 2001).

Water scarcity can be an issue even in places where there is a great deal of water.

Most of the southern tip of Florida is essentially one huge wetland – the Everglades –

that covers many thousands of square kilometers in a sheet of water. Yet the

Everglades is so shallow, and the demands on its water from farmers and coastal communities

are so great, that the whole ecosystem is being profoundly changed by a

scarcity of water (Davis and Ogden 1994). Notably, the numbers of herons, egrets,

and other wading birds have declined sharply, in part because a reduction in freshwater

input has reduced the productivity of estuarine parts of the Everglades.

164 Part II Threats to Biodiversity

Deforestation

■ Forests cover less than 6% of the earth’s total surface area.

■ Forests are habitat for a majority of the earth’s known species.

■ Forests are being lost faster than they are growing.

These three facts highlight why many conservation biologists believe that deforestation

may be the most important direct threat to biodiversity. In this section we will

first review some of the causes, and then some of the consequences, of deforestation.

Causes of Deforestation

Forests tend to grow in places with reasonably fertile soils and benign climates, not too

dry and not too cold. These also tend to be good places for people to live and grow crops.

Consequently, millions of square kilometers of forests have been removed to make way

for our agriculture, homes, businesses, mines, and reservoirs since the beginning of

agriculture (Williams 2003). This process has slowed, stopped, or even reversed in some

areas that were extensively deforested many years ago, such as Europe, China, and eastern

North America. In some developed countries, the demand for forest land is less

because the human population has stabilized, or because the local economy has shifted

from agriculture (the single biggest cause of deforestation) to industry. In other places,

such as large parts of China, there are simply few forests left to remove. Unfortunately,

deforestation continues at an alarming pace in many tropical regions. The statistics

vary widely – an area the size of Switzerland every year, nearly 50,000 ha every day,

and so on – and we do not really have a good estimate, but the basic fact remains: forests

are disappearing, especially tropical forests (Williams 2003). The fundamental reasons

for the current spate of tropical deforestation are threefold. First, human populations

are increasing rapidly in most tropical areas. Second, many of these people are poor,

and clearing forest to open a small plot where crops can be grown is often their only

choice for survival. Third, corporations and wealthy individuals cut forests for wood

products with inadequate attention to regrowth (especially in Asia) and to open the

land for cattle ranching (especially in Latin America).

Unfortunately, poor farmers are often trapped in poverty because the lands they clear

are not really suitable for agriculture in the first place. After only a few years the soil’s fertility

is drained, and they must move on to another site and clear more forest. The process

of clearing a small patch of tropical forest, growing crops for a few years, and then moving

on to another site is called shifting cultivation and it is a traditional, sustainable practice

when human populations are low and the abandoned site is allowed to return to

forest. However, when populations are too high, then people stay at a site too long or

return to a previously used site too soon. Alternatively, they may sell the land to a wealthy

cattle rancher. Particularly in Latin America, much of the tropical forest initially cleared

for subsistence agriculture ends up as rangeland for cattle, while under some circumstances

the cattle ranchers raze the forest themselves (Fearnside 2005). In Asia, the direct

drivers of deforestation are often logging companies. Whatever the underlying reason,

abusive use of a site is likely to degrade the soil so badly that, even when it is abandoned, it

will probably take several centuries, or even millennia, for a rich forest to return. Tropical

forest soils are notorious for being easily degraded and difficult to reforest (Lal 1995).

In many people’s eyes timber harvesting is a major cause of deforestation. For example,

Pimm (1991, p. 136) wrote “consider the ultimate form of external environmental

Ecosystem Degradation and Loss 165

disturbance – total destruction of the habitat, such as might result from logging of a forest,

or an asteroid collision, or a nuclear holocaust.” This viewpoint needs to be scrutinized,

however. A forest can be profoundly disturbed by severe fires or windstorms, but in

time the forest will be restored by ecological succession. Similarly, when a forest is

clearcut, it will eventually return to a forest again if it is given enough time and freedom

from additional disturbances such as plows and cattle and real estate developers

(Fig. 8.9). It may or may not resemble a forest that was disturbed by natural phenomena,

but it will be a forest. Time is the critical issue here. Calling a clearcut forest deforested is

probably appropriate only if its recovery will take significantly longer than recovery from

a natural disturbance. Note that under some circumstances logging can negatively affect

a forest even if only a small portion of the trees are removed, but this is more appropriately

called degradation than deforestation. This issue will be covered in Chapter 9, and

in Chapter 12 we will address ways to harvest wood and maintain biodiversity.

Consequences of Deforestation

The extraordinary species diversity of forests is based on a number of factors (Hunter

1990); here are four key ones. First and most basically, the environmental conditions

that forests require – some soil and a reasonably benign climate – are favorable to life in

general. Contrast the places where forests grow to a tundra or desert. Second, the durability

of wood means that forests contain an enormous reservoir of organic matter, and

this material represents food and shelter to a large set of invertebrates, fungi, and

microorganisms. For example, just two families of wood-boring beetles – long-horned

beetles and metallic wood borers – contain twice as many species as all the world’s

bird, mammal, reptile, and amphibian species combined (Hunter 1990). Third, the

strength of wood makes forests taller, more three-dimensional, than other terrestrial

ecosystems. The height of a forest means that it contains many different microenvironments,

from the sunny, windy foliage at the top of the canopy to the cool, damp

recesses of a crack in the bark of a tree trunk, and each of these different microenvironments

may support a different set of small creatures. Fourth, forests are dynamic

ecosystems, frequently changing through the processes of disturbance and succession,

and many of these changes are marked by differences in species composition.

Among all forests, the most diverse are the tropical rain forests. Indeed, many biologists

believe that half of all the species on earth may occur in tropical rain forests (Wilson

1992). Our knowledge is too limited to corroborate this statement (as was explained in

Chapter 3), but we can consider many fragmentary bits of supporting evidence. For

example, 43 species of ants have been found on one tree in a Peruvian tropical forest,

about equal to the number that occur in all of Great Britain, and 1000 tree species were

found collectively in ten 1 ha plots in Borneo, far more than occur in all of the United

States and Canada (Wilson 1992). The reasons for the extraordinary diversity of tropical

forests are complex and not well understood (Hill and Hill 2001). Suffice it to say here

that the four factors mentioned above probably play a role (for example, tropical rain

forests are taller and have larger reservoirs of organic matter than many other types of

forest), as well as other factors such as long-term climate change.

Needless to say, when people convert a forest to another type of ecosystem, most of the

forest-dependent species are lost from that site for some period. It is easy to name forestdwelling

species that are threatened with extinction largely because of deforestation – giant

166 Part II Threats to Biodiversity

pandas, tigers, gorillas, and many many more – but, of course, these are just the tip of the

iceberg. With most of the earth’s biodiversity residing in insects and other small organisms,

and with many, perhaps most, of these small species living in tropical forests where they

remain unknown to science, we can only make gross estimates of the likely impact of

deforestation (Lawton et al. 1998). Fully acknowledging the extent of our uncertainty, it is

still clear that a large portion of the earth’s biodiversity is found in tropical forests and that

these forests are being lost to deforestation at a very high rate. Consequently, all conservation

biologists believe that protection of tropical forests must be a high priority.

Ecosystem Degradation and Loss 167

Figure 8.9

Clearcuts have a

dramatic effect on

forest biota but the

key issue is what

happens in the following

years; will

the forest regenerate

or will it be

converted to

another use, such

as housing or agriculture,

and thus

constitute deforestation?

We also

need to consider to

what extent a

clearcut does or

does not resemble

the natural disturbance

regime for a

particular type of

forest. (Photo from

Marc Adamus.)

Thus far we have focused on the biological consequences of deforestation, but

through changes in the physical environment, deforestation can have effects far

beyond the edge of the forest. We have already discussed soil erosion as a source of sediment

that can contaminate aquatic ecosystems. On a global scale, forests affect the

earth’s climate by acting as reservoirs of carbon, and when they are cut, much of the

carbon moves into the atmosphere as carbon dioxide, the major greenhouse gas

(Steininger 2004). More locally, because much of the water vapor in the atmosphere

above a forest is maintained by evaporation and transpiration, when a forest is cut,

rainfall may decrease. This makes the hot, dry conditions of a deforested site even hotter

and drier.

Desertification

When you envision a barren, nearly lifeless landscape, do you think of deserts? This

image ignores the myriad species that flourish in desert ecosystems, but nevertheless,

fewer species overall live in arid environments than in more humid ones. Therefore it

is of great concern to conservationists that the extent of arid land – currently about

35% of the earth’s land surface – is apparently increasing because of human activities

(Mainguet 1999). In particular, grasslands and woodlands (i.e. relatively dry

forests in which tree crowns do not meet to form a continuous canopy) are being

degraded until they are dominated by sparse, relatively unproductive vegetation

(Fig. 8.10). This process is called desertification.

Causes of Desertification

In most parts of the world desertification is closely associated with overgrazing

(Schlesinger et al. 1990; Asner et al. 2004). Too many cattle, sheep, goats, and other

livestock consume and trample too many plants, and this alters the species composition

and structure of the vegetation and reduces the overall biomass. With few plants

to protect the soil and with many animal hooves breaking and compacting the soil,

erosion is likely to increase. The excessive burning of grasslands, usually to provide

fodder for livestock, may further exacerbate the problem (Savory and Butterfield

1999), while suppression of natural fire regimes can lead to the encroachment of

shrubs (Asner et al. 2004).

Cultivation is also a major cause of desertification (Dregne 2002), particularly because

it generates soil erosion. Furthermore, croplands that require irrigation often face two

other problems: salinization and waterlogging (Contreras-B. and Lozano-V. 1994;

Mainguet 1994). Salinization is common when irrigation is used in arid environments

because large volumes of water evaporate, leaving behind salts that can reach toxic concentrations.

If farmers try to solve this problem by using enough water to leach the salts

lower into the soil, waterlogged soils can occur. Cutting trees in woodlands, usually for

fuelwood, can also contribute to desertification.

Over the long term, whenever cyclical changes in the earth’s orbit have led to

warmer and drier conditions, some grasslands and woodlands have become deserts

(see Chapter 6). Against this background, the relative importance of long-term climate

change and short-term droughts, natural erosion, and human-induced causes of

desertification is a complex and controversial topic. Some argue that anthropogenic

168 Part II Threats to Biodiversity

factors are paramount; others

argue for climate change; and

their relative role seems to depend

on what part of the globe you are

talking about (Geist and Lambin

2004).

Consequences of

Desertification

Desertification and its consequences

are often overlooked until

they become extreme, in part

because it is harder to recognize

the work of hungry livestock (the

cumulative impact of thousands of

small bites) than the work of a

hungry chainsaw (Fleischner

1994). A deforested site often looks

like a disaster, but an overgrazed

ecosystem where grasses have been

replaced by unpalatable brush may

not look degraded to the untrained

eye. Grasslands and woodlands

that are vulnerable to desertification

may not match the wealth of

biodiversity of forests, but they do

have a large set of unique species

that merit the attention of conservation

biologists, including such

well known species as African elephants,

cheetahs, black-footed ferrets,

both black and white rhinos,

great bustards, and African wild

dogs. Furthermore, in decrying the

loss of grasslands and woodlands

to desertification, it is important

not to imply that deserts lack biodiversity

value. Thousands of species

are found in deserts, and many of

them are highly endangered:

desert tortoises; Asian and African

wild asses; sundry species of cactus;

and a variety of antelopes

such as the addax, scimitar-horned oryx, and Arabian oryx, to name some of the better

known taxa.

Ecosystem Degradation and Loss 169

Figure 8.10 This photo from the Khyber Pass in Afghanistan reveals some

of the classic signs of desertification: virtually no ground vegetation (at

least of palatable plants), a browse line on the tree indicating how high

livestock can reach, and soil erosion. (Photo from M. Hunter.)

It is instructive to think of a continuum of decreasing ecosystem biomass and productivity

from forests to woodlands to grasslands to deserts. Ecosystems that already

fall in the desert part of this continuum are still vulnerable to being pushed further

down the continuum of decreasing productivity and biomass. This perspective raises

the possibility that some species adapted to the lower end of this continuum might

benefit from desertification by having larger areas of habitat (Whitford 1997). This

may be true of some common, highly adaptable species, but the species of greatest

concern are likely to be habitat specialists that cannot survive in degraded ecosystems

that are a human-created facsimile of natural desert.

One reason why desertification has had a significant impact on biodiversity is that

relatively few grasslands and woodlands have been protected as parks (Hoekstra et al.

2005). This is partly because these lands usually lack the amenities – lakes, mountains,

forests – that people seek for outdoor recreation. (A notable exception to this

generalization comes from eastern and southern Africa, where tourists visit arid and

semiarid parks to see the spectacular suite of large mammals.) Of course, establishing

some more parks would not be a complete solution; wiser management of all ecosystems

vulnerable to desertification must be the goal.

Draining, Dredging, Damming, etc.

Swamps and marshes, bogs and fens, lakes and ponds, rivers and streams, estuaries

and the ocean, and more: there is a wide variety of ecosystems – freshwater

ecosystems, marine ecosystems, and wetlands – in which water is a medium for life,

not just an essential nutriment. Similarly, there is a wide variety of ways in which

people destroy these ecosystems by changing their hydrology (Fig. 8.11). We will

begin by briefly reviewing some of these methods.

Filling a wet depression with material until the surface of the water table is well

below ground is an obvious way to turn a wet ecosystem into a dry one. This method

is usually too expensive to use for creating agricultural land, but it is routinely used to

create house lots, airports, parking lots, and other high-priced land. Small, shallow

wetlands are particularly vulnerable to being filled.

Draining a wet ecosystem (i.e. lowering the water table by moving the water somewhere

else) is a common practice. In its simplest form it involves digging ditches that

allow the water to drain away. Under the right circumstances, this method can be used

to drain large areas relatively easily. Occasionally, water is actually pumped out of a

wet ecosystem at great expense.

The primary impetus for both draining and filling is to acquire more land that is useful

for human enterprises. The single biggest use for land created in this fashion is agriculture,

except in urban and suburban areas where housing developments, shopping

malls, and other projects are often the key issue. Occasionally, sites are drained to

improve their ability to produce timber, and in some countries peatlands are drained so

that the peat can be mined for fuel. Clearly, it is easier to drain or fill a shallow basin

than a deep one, and thus wetlands are far more vulnerable to these losses than are

lakes, rivers, and estuaries.

Dredging involves digging up the bottom of a water body – the mud and a host of muddwelling

creatures – and depositing the material elsewhere, often in a wetland that someone

wants filled. The goal is usually to maintain a shipping channel in a river or harbor;

170 Part II Threats to Biodiversity

Ecosystem Degradation and Loss 171

the ecological result is a scarred bottom and sediment pollution. Sometimes, the sediments

contain high concentrations of toxins that are returned to the food web after dredging.

Channelizing rivers and streams means making them straighter, wider, and deeper

and replacing riparian (shoreline) vegetation with banks of stone or concrete. This

conversion from a complex of natural riverine communities to a barren canal may

meet engineering objectives, usually flood control, but is obviously an environmental

calamity. Sometimes canals are dug to connect separate water bodies; these can

become conduits that allow the mixing of formerly isolated biotas (Smith et al. 2004).

Figure 8.11 A

complex of aquatic

ecosystems before

and after human

alterations. In the

lower right a housing

development

that was previously

surrounded by

dikes is being

extended by filling

the wetland.

Nearby, the channel

is being

dredged. Upstream

the river has been

channelized and

the adjacent wetlands

ditched. A

tributary on the

right side of the

main river has

been dammed to

create a reservoir.

In the real world it

would be highly

unusual to have all

these activities in a

small area.

Damming rivers and streams can profoundly change ecosystems both upstream and

downstream (Nilsson and Berggren 2000; Bunn and Arthington 2002). First,

upstream of a dam, a flowing-water ecosystem (the technical term is lotic) is converted

to a standing-water (lentic) ecosystem, and wetland and upland ecosystems will also be

flooded and thus become part of a reservoir. Wetlands are especially likely to be extensively

flooded because their elevation is often close to that of a nearby river.

Additionally, many reservoirs are subject to dramatic fluctuations in water level

depending on changing demands for electricity and water. This means that the shores

of reservoirs are often quite barren because relatively few species can cope with being

inundated and then exposed in this manner (Jansson et al. 2000a). Second, downstream

of a dam, floodplain ecosystems are likely to be replaced by upland ecosystems

if the dam minimizes or eliminates the seasonal floods that are critical to the maintenance

of these ecosystems. In the river itself, species are likely to be challenged by flow

rates that are very unnatural: too much short-term fluctuation in response to demands

for water or electricity, or not enough annual fluctuation in response to rainy and dry

seasons. Also, the water temperature may be too warm (if drained from the top of the

reservoir) or too cold (if drained from the bottom of the reservoir) (Vaughn and Taylor

1999). A third issue, dams as barriers to the movements of aquatic species, was discussed

above in the section on roads and dams as barriers.

Diking consists of constructing earthen banks, usually called dikes or levees, along the

edges of water bodies to prevent flooding. Given that floods are natural phenomena vital

to the maintenance of many types of ecosystems, diking can easily destroy ecosystems,

especially because it is often linked with developing land for other purposes.

Obviously, the world’s oceans and seas are too large to be converted to other types of

ecosystems by filling, draining, etc., but they are not completely immune to these

processes. The bays and inlets that line oceans and seas (often these are estuaries where

salt and fresh waters meet) are small enough to be affected by these processes, especially

filling and dredging. Furthermore, sometimes our attempts to control currents in these

areas with breakwaters, jetties, and other structures can change marine ecosystems

profoundly. For example, shortsighted attempts to maintain sandy beaches by building

jetties often end up accelerating beach erosion and sand deposition somewhere else.

To discuss the consequences for biodiversity of filling, draining, dredging, channelizing,

damming, and diking, we will focus on the two groups of species that are most

vulnerable to these processes: those associated with wetlands and rivers. In the wake

of devastating tsunamis, hurricanes, and floods, the consequences of degrading

shoreline ecosystems is of great concern for human communities too, albeit beyond

our scope here. Suffice it to say that the impacts of natural disasters are much

less severe where shoreline ecosystems are intact enough to provide a buffer

(Danielsen et al. 2005).

Consequences for Wetland Biota

Stemming the loss of wetlands has become a major goal of conservationists for two

basic reasons: the rarity of wetlands and their ecological value. Wetlands cover a relatively

small portion of the earth’s total surface, roughly 1–2%, and this portion is

decreasing (Harcourt 1992). In the conterminous United States, roughly 53% of wetlands

were lost between the 1780s and 1990s (Dahl 2000), and worldwide figures

172 Part II Threats to Biodiversity

are probably roughly comparable (Dugan 1993; Mitsch and Gosselink 2000). These

facts alone make it imperative to protect remaining wetlands, given a goal of protecting

biodiversity at the ecosystem level (see Chapter 4). Furthermore, wetlands are

often keystone ecosystems, playing critical roles in a landscape through hydrological

processes, biomass production and export, removal of contaminants from polluted

water, and so forth. (See Mitsch and Gosselink 2000 for a review of this topic.)

At the species level of biodiversity, wetlands are important because they are habitat

for a diverse biota comprising three groups of species. First, there are species that are

primarily aquatic (such as many species of fish and insects) that can use the pools of

water often found in wetlands. Some may be permanent residents; some may be visitors,

coming only at high tide, or during spring or monsoonal high waters.

Second, many terrestrial species are facultative users of wetlands, with a portion of

their population found in wetlands. Wetlands can be particularly important refugia for

terrestrial species that are sensitive to human interference; this is because wetlands

tend to be too wet for humans to hunt, plow, or extract trees and too dry for them to

access by boat. For example, the mangrove swamps in the mouth of the Ganges River,

the Sunderbans, harbor one of the world’s largest remaining tiger populations.

Finally, there are many thousands of species that are uniquely adapted to the interface

of wet and dry environments found in wetlands. These include whole families of

plants (cattails, water lilies, bur-reeds, and many more) and insects (e.g. predaceous

diving beetles, water boatmen, and several families of damselflies and dragonflies)

that are almost exclusively found in wetlands. Among vertebrates, most amphibians

and turtles are wetland species.

Throughout the world the loss of wetlands has pushed many species toward

extinction. Nine of the world’s 15 species of cranes – birds that require wetlands for

breeding and often foraging – are in jeopardy. In recent years herpetologists have been

alarmed by precipitous drops in many frog populations, and wetland loss is a primary

cause (Houlahan et al. 2000; Beebee and Griffiths 2005).

Consequences for River Biota

Rivers and streams are often likened to the arteries of a landscape, and this metaphor

is apt from both an ecological and economic perspective. It is hard to imagine human

history without rivers – bringing water to our croplands and homes, driving waterwheels

and turbines, providing a transportation network, and carrying away our

wastes. Think about how many of the world’s cities are located on a river, and you

will appreciate their pivotal role.

Unfortunately, being the focus of so much attention has left many rivers badly

degraded by water pollution, channelization, and dredging, or converted to reservoirs

by dams (Malmqvist and Rundle 2002; Postel and Richter 2003). The victims

of this scarcity of clean, free-flowing rivers do not draw much public attention

because they are chiefly fish, mollusks, and insects, not the birds and mammals that

galvanize public support (Allan and Flecker 1993). Scores of riverine fish species are

threatened with extinction, but most of them are minnows and other small species

that are seldom seen. Only a few economically important fish species such as various

salmon species are likely to garner much attention. Even lower on the list of public

popularity are mussels, crayfish, and other invertebrates, even though hundreds,

Ecosystem Degradation and Loss 173

perhaps thousands, of species are endangered by river degradation and conversion.

One analysis of North American crayfishes and unionid mussels estimated that 63%

of the crayfish species (198 of 313) and 67% of the unionid mussels (201 of 300)

were either extinct or at some level of risk (Master 1990). Another analysis of the

freshwater fauna of North America demonstrated that the recent (since 1900)

extinction rate of these animals was about five times greater than that of terrestrial

vertebrates and that this difference was likely to persist in the future (Ricciardi and

Rasmussen 1999). A similarly dramatic story could be told for Asian rivers – home

to over half of the world’s large dams (over 15 meters tall) and a large portion of the

world’s freshwater crabs, snails, turtles, crocodilians, river dolphins, and fishes

(Dudgeon 2000, 2002). For example, there are 105 families of freshwater fishes in

Asia compared with 74 in Africa and 60 in South America. For many taxa we do not

even have enough information to evaluate rarity or endangerment. For example,

388 algal species were recorded in one stream in southern Ontario (Moore 1972),

but few streams have been inventoried this thoroughly, and thus virtually all of their

algal species could be eradicated without documentation of their disappearance.

Fragmentation

When early explorers of wild regions found a high vantage point from which to scan

the terrain, they often wrote of a “sea of green” to convey the unbroken vastness of

the forests and grasslands they traversed. A modern traveler, looking down from a

plane, is likely to describe a typical landscape as a “patchwork quilt” – a mosaic of pastures

and croplands, woodlots and house lots and parking lots. The process by which a

natural landscape is broken up into small parcels of natural ecosystems, isolated from

one another in a matrix of lands dominated by human activities, is called

fragmentation. Because fragmentation almost always involves both loss and isolation

of ecosystems, researchers would like to distinguish between the effects of these two

processes but it is not often practical to do so (Guerry and Hunter 2002; Fahrig 2003).

Fragmentation is a major focal point for conservation biologists, both because it has

degraded many landscapes and because many nature reserves have become isolated

fragments or are in danger of becoming so (Saunders et al. 1991). In addition, it captured

the interest of many conservation biologists because it was recognized as an issue

at about the same time that conservation biology was emerging as a new discipline; in

other words, it was new ground for conservation biology to plow. Furthermore, it

appeared to have a theoretical foundation in an intriguing body of ideas and observations

known as island biogeography (Box 8.1). It seemed reasonable to assume that the

effects of isolation on the biota of oceanic islands might provide a model for understanding

the effects of isolation on populations inhabiting patches of natural ecosystems that were

isolated in a sea of human-altered land.

Most conservation biologists have come to recognize that the applicability of island

biogeography theory to fragmentation issues is quite limited, primarily because fragmentation

“islands” are not nearly as isolated for most species as true oceanic islands

(Zimmerman and Bierregaard 1986; Debinski and Holt 2000; Haila 2002).

Nevertheless, island biogeography does provide a conceptual foundation for understanding

fragmentation and is the origin for two important ideas. Small fragments

(or islands) have fewer species than large fragments, and more isolated fragments

174 Part II Threats to Biodiversity

have fewer species than less isolated fragments. We will begin by considering these

two ideas further.

Fragment Size and Isolation

There are three main reasons why large fragments have more species than small

fragments (Fig. 8.13). First, a large fragment will almost always have a greater variety

of environments than a small fragment (e.g. different types of soil, a stream, a

rock outcrop, an area recently disturbed by fire), and each of these will provide

niches for some additional species.

Second, a large fragment is likely to have both common species and uncommon

species (i.e. species that occur at low densities), but a small fragment is likely to have

only common species. This idea is easy to grasp when we consider species that have

large home ranges; for example, it means that we are unlikely to find a bear in a tiny

fragment. However, it also applies to species that have rather limited home ranges but

still actively avoid small fragments. For example, certain small birds such as Sprague’s

pipits and grasshopper sparrows have home ranges of only a few hectares, but are

usually not found in habitat fragments less than 100 ha in size (Davis 2004). Species

that do not occur in small patches of habitat are called area-sensitive species and are

often of concern to conservationists. Furthermore, uncommon species that are not

area-sensitive (i.e. that can find habitat in a small fragment) are also unlikely to occur

in a small patch by chance alone. This last point is a subtle one that is often overlooked

(Haila 1999), but it is easily explained with an example. Imagine there was an

uncommon tree species that had an average density of one individual per 1000 ha;

all other things being equal, a 100 ha sample plot would have a 1:10 chance of

Ecosystem Degradation and Loss 175

BOX 8.1

Island biogeography theory

The fundamental idea of MacArthur and Wilson’s (1967) equilibrium theory

of island biogeography is that the number of species on an island represents

a balance between immigration and extinction. The rate of

immigration is determined largely by how isolated an island is; the more

isolated, the lower its immigration rate. This is represented in Fig. 8.12,

with the curve for remote islands (far) being lower than the curve for

islands that are near the mainland (near). Extinction rates are a function of

island size; populations on large islands tend to be larger and thus less vulnerable

to extinction. In Fig. 8.12 the extinction curve for large islands is

lower than the curve for small islands.

For any given island there is an extinction rate and an immigration rate

that will balance one another and keep the number of species relatively constant.

In this example, the numbers of species for four equilibria are represented

as follows: SFS, number of species on a far, small island; SFL, far,

large island; SNS, near, small island; SNL, near, large island. P is the total

number of species that could potentially immigrate to the island from a

nearby landmass.

Figure 8.12 A graphical representation

of island biogeography theory.

(From Hunter 1990, reprinted

by permission of Prentice-Hall,

Englewood Cliffs, New Jersey.)

176 Part II Threats to Biodiversity

containing this species, but a 10

ha plot would have only a 1:100

chance. This sampling effect, added

across many species, would mean

that a small fragment would have

fewer species than a large fragment

simply because it is a smaller sample.

To adjust for this phenomenon,

fragmentation studies should focus

on number of species per unit area

(e.g. Rudnicky and Hunter 1993),

but most only report the number of

species in each fragment.

Third, small fragments will, on

average, have smaller populations

of any given species than large

islands, and a small population is

more susceptible to becoming

extinct than a large population

(Henle et al. 2004). This idea was a

key point in the preceding chapter.

Fragments that are isolated from

other, similar patches by great distances

or by terrain that is especially

inhospitable are likely to

have fewer species than less isolated

fragments for two reasons.

First, relatively few individuals of a

given species will immigrate into

an isolated fragment. Immigrating

individuals are important both

because they can “rescue” a small

population from extinction and

because they can replace a population

that has already disappeared

(Brown and Kodric-Brown 1977).

Second, species that are mobile

enough to use an “archipelago” of small habitat patches to collectively comprise a

home range are less likely to use an isolated fragment simply because it is inefficient to

visit it. For example, the copperbelly water snake travels among ephemeral wetlands

foraging for frogs and it seems to fare badly when wetlands are lost and the average

distance among the remaining wetlands increases (Roe et al. 2004).

Causes of Fragmentation

The fundamental cause of fragmentation is expanding human populations converting

natural ecosystems into human-dominated ecosystems. Fragmentation typically

Figure 8.13 The number of species in a sample plot or on an island

increases as area increases, but the steepness or slope of the curve

varies considerably among taxa. Note that in these graphs for taxa on

islands in the Baltic Sea some of the y axes are linear and some are logarithmic.

All of the x axes are logarithmic. Recall from Chapter 6 that

these lines are described by the formula S = CAz, where S is number of

species, A is area, and C and z are constants. (Redrawn from JÀrvinen

and Ranta 1987.)

Ecosystem Degradation and Loss 177

begins when people dissect a natural landscape with roads and then perforate it by

converting some natural ecosystems into human-dominated ones (Fig. 8.14). It culminates

with natural ecosystems reduced to tiny, isolated parcels. Thus fragmentation

almost always involves both reducing the area of natural ecosystems and increasing

their isolation, although some authors have advocated reserving the term for isolation

(Fahrig 2003). As the single largest user of land, agriculture is the proximate cause of

most fragmentation. Certainly, for many terrestrial species, a large expanse of cropland

is a barrier nearly as effective as a stretch of water. Urban and suburban sprawl

may be a more effective barrier to movement, but their total area is much more limited

than that of agriculture. Some writers use “fragmentation” to describe any

process that breaks up extensive ecosystems, including natural events such as fires,

whereas other writers restrict the term to human-induced changes. In any case,

human activities are the major cause of fragmentation in most landscapes.

Sometimes, it is unclear whether human land uses cause fragmentation. Consider

clearcutting forests; if this leads to the forest’s being converted to farmland, then

clearcutting obviously contributes to fragmentation. However, if the clearcut site is

allowed to undergo succession and return to forest, this may or may not constitute

fragmentation, depending on whether the clearcut is extensive enough to constitute a

significant barrier to the movement of plants and animals (Haila 1999, 2002). Of

course, this will vary from species to species. A slow-moving, moisture-loving slug is

far more likely to be deterred by a clearcut than most birds that can fly across a

clearcut in a few seconds. Similarly, at what point on the continuum of desertification

does fragmentation occur? A plant whose seeds are dispersed long distances by wind

may cross a desertified barrier easily, whereas a short-dispersal plant may be incapable

of crossing the barrier in one trip and unable to establish a population halfway

across in the degraded habitat.

Consequences of Fragmentation

Ecosystem destruction is the driving force behind fragmentation, and thus it is

inevitable that fragmentation is associated with negative effects on biodiversity. The

reason why fragmentation elicits so much special concern from conservationists is that

its consequences are greater than we would anticipate based solely on the area of

ecosystems destroyed. Notably, remnant ecosystems that seem to have escaped destruction

may no longer be available for area-sensitive species that cannot use small patches

of habitat. Most prominent among these are large predators that need extensive home

ranges to find enough prey (Crooks 2002). Some small species with limited home

ranges also avoid small habitat patches: for example, birds (Davis 2004) and beetles

(Laurance et al. 2002). This may occur because they require the microclimate characteristic

of the interior of large habitat patches, or because they select habitat patches

large enough to support other members of their species (a type of loose coloniality)

(Stamps 1991), or because of their interactions with other biota as predators, prey, or

competitors (Gibbs and Stanton 2001).

In highly fragmented landscapes, it is difficult for individuals (usually juvenile animals,

seeds, or spores) to disperse to another suitable patch of habitat. If immigration

and emigration are very limited, then the individuals occupying a fragment may effectively

constitute a small independent population and, as we saw in Chapter 7, small

178 Part II Threats to Biodiversity

Figure 8.14

People usually initiate

fragmentation

by building a road

into a natural landscape,

thereby dissecting

it. Next,

they perforate the

landscape by converting

some natural

ecosystems into

agricultural lands.

As more and more

lands are converted

to agriculture,

these patches coalesce

and the natural

ecosystems are

isolated from one

another; at this

stage fragmentation

has occurred.

Finally, as more of

the natural patches

are converted,

becoming smaller

and farther apart,

attrition is occurring.

(Terminology

from R. Forman,

personal communication,

and 1995;

also see Collinge

and Forman 1998.)

populations are more likely to disappear. Furthermore, if a population

does disappear, a low immigration rate will mean it takes much

longer to establish a new population. Even if fragmentation only

leads to partial isolation, this may change one large population into a

metapopulation, which may also affect population viability and persistence.

The dispersal of fire is also an issue; fragmentation has

greatly disrupted natural fire regimes in regions where fires once

swept across the landscape (Van Lear et al. 2005).

The migration of animal species that travel between habitats seasonally

could be impeded by fragmentation (Hunter 1997). In practice, this

is likely to be a problem mainly for species that walk, such as large

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Prologue Autumn Aroma

Prologue Autumn Aroma

Takamato ridge, crowded with expanding caps, filling up, thriving— the wonder of autumn aroma.

— From the eighth- century Japanese poetry collection Man- nyo Shu

WhAt do you do when your world StArtS to FAll apart? I go for a walk, and if I’m really lucky, I find mushrooms. Mush- rooms pull me back into my senses, not just— like flowers— through their riotous colors and smells but because they pop up unexpectedly, reminding me of the good fortune of just happening to be there. Then I know that there are still pleasures amidst the terrors of indeterminacy.

Terrors, of course, there are, and not just for me. The world’s climate is going haywire, and industrial progress has proved much more deadly to life on earth than anyone imagined a century ago. The economy is

Elusive life, Oregon. Matsutake caps emerge

in the ruin of an industrial forest.

2 Prologue

no longer a source of growth or optimism; any of our jobs could disap- pear with the next economic crisis. And it’s not just that I might fear a spurt of new disasters: I find myself without the handrails of stories that tell where everyone is going and, also, why. Precarity once seemed the fate of the less fortunate. Now it seems that all our lives are precarious— even when, for the moment, our pockets are lined. In contrast to the mid- twentieth century, when poets and philosophers of the global north felt caged by too much stability, now many of us, north and south, confront the condition of trouble without end.

This book tells of my travels with mushrooms to explore indetermi- nacy and the conditions of precarity, that is, life without the promise of stability. I’ve read that when the Soviet Union collapsed in 1991, thou- sands of Siberians, suddenly deprived of state guarantees, ran to the woods to collect mushrooms.1 These are not the mushrooms I follow, but they make my point: the uncontrolled lives of mushrooms are a gift— and a guide— when the controlled world we thought we had fails.

While I can’t offer you mushrooms, I hope you will follow me to savor the “autumn aroma” praised in the poem that begins my pro- logue. This is the smell of matsutake, a group of aromatic wild mush- rooms much valued in Japan. Matsutake is loved as a marker of the au- tumn season. The smell evokes sadness in the loss of summer’s easy riches, but it also calls up the sharp intensity and heightened sensibili- ties of autumn. Such sensibilities will be needed for the end of global progress’s easy summer: the autumn aroma leads me into common life without guarantees. This book is not a critique of the dreams of mod- ernization and progress that offered a vision of stability in the twentieth century; many analysts before me have dissected those dreams. Instead, I address the imaginative challenge of living without those handrails, which once made us think we knew, collectively, where we were going. If we open ourselves to their fungal attractions, matsutake can catapult us into the curiosity that seems to me the first requirement of collabora- tive survival in precarious times.

Here’s how a radical pamphlet put the challenge:

The spectre that many try not to see is a simple realisation— the world will not be “saved.” . . . If we don’t believe in a global revolutionary fu- ture, we must live (as we in fact always had to) in the present.2

autumn aroma 3

When Hiroshima was destroyed by an atomic bomb in 1945, it is said, the first living thing to emerge from the blasted landscape was a mat- sutake mushroom.3

Grasping the atom was the culmination of human dreams of con- trolling nature. It was also the beginning of those dreams’ undoing. The bomb at Hiroshima changed things. Suddenly, we became aware that humans could destroy the livability of the planet— whether intention- ally or otherwise. This awareness only increased as we learned about pol- lution, mass extinction, and climate change. One half of current precar- ity is the fate of the earth: what kinds of human disturbances can we live with? Despite talk of sustainability, how much chance do we have for passing a habitable environment to our multispecies descendants?

Hiroshima’s bomb also opened the door to the other half of today’s precarity: the surprising contradictions of postwar development. After the war, the promises of modernization, backed by American bombs, seemed bright. Everyone was to benefit. The direction of the future was well known; but is it now? On the one hand, no place in the world is untouched by that global political economy built from the postwar development ap- paratus. On the other, even as the promises of development still beckon, we seem to have lost the means. Modernization was supposed to fill the world— both communist and capitalist— with jobs, and not just any jobs but “standard employment” with stable wages and benefits. Such jobs are now quite rare; most people depend on much more irregular livelihoods. The irony of our times, then, is that everyone depends on capitalism but almost no one has what we used to call a “regular job.”

To live with precarity requires more than railing at those who put us here (although that seems useful too, and I’m not against it). We might look around to notice this strange new world, and we might stretch our imaginations to grasp its contours. This is where mushrooms help. Mat- sutake’s willingness to emerge in blasted landscapes allows us to ex- plore the ruin that has become our collective home.

Matsutake are wild mushrooms that live in human- disturbed forests. Like rats, raccoons, and cockroaches, they are willing to put up with

4 Prologue

some of the environmental messes humans have made. Yet they are not pests; they are valuable gourmet treats— at least in Japan, where high prices sometimes make matsutake the most valuable mushroom on earth. Through their ability to nurture trees, matsutake help forests grow in daunting places. To follow matsutake guides us to possibilities of coexis- tence within environmental disturbance. This is not an excuse for further damage. Still, matsutake show one kind of collaborative survival.

Matsutake also illuminate the cracks in the global political econ- omy. For the past thirty years, matsutake have become a global com- modity, foraged in forests across the northern hemisphere and shipped fresh to Japan. Many matsutake foragers are displaced and disenfran- chised cultural minorities. In the U.S. Pacific Northwest, for example, most commercial matsutake foragers are refugees from Laos and Cam- bodia. Because of high prices, matsutake make a substantial contribu- tion to livelihood wherever they are picked, and even encourage cul- tural revitalizations.

Matsutake commerce, however, hardly leads to twentieth- century development dreams. Most of the mushroom foragers I spoke with have terrible stories to tell of displacement and loss. Commercial foraging is a better than usual way of getting by for those with no other way to make a living. But what kind of economy is this anyway? Mushroom foragers work for themselves; no companies hire them. There are no wages and no benefits; pickers merely sell the mushrooms they find. Some years there are no mushrooms, and pickers are left with their ex- penses. Commercial wild- mushroom picking is an exemplification of precarious livelihood, without security.

This book takes up the story of precarious livelihoods and precari- ous environments through tracking matsutake commerce and ecology. In each case, I find myself surrounded by patchiness, that is, a mosaic of open- ended assemblages of entangled ways of life, with each further opening into a mosaic of temporal rhythms and spatial arcs. I argue that only an appreciation of current precarity as an earthwide condition allows us to notice this— the situation of our world. As long as authori- tative analysis requires assumptions of growth, experts don’t see the het- erogeneity of space and time, even where it is obvious to ordinary par- ticipants and observers. Yet theories of heterogeneity are still in their

autumn aroma 5

infancy. To appreciate the patchy unpredictability associated with our current condition, we need to reopen our imaginations. The point of this book is to help that process along— with mushrooms.

About commerce: Contemporary commerce works within the con- straints and possibilities of capitalism. Yet, following in the footsteps of Marx, twentieth- century students of capitalism internalized progress to see only one powerful current at a time, ignoring the rest. This book shows how it is possible to study capitalism without this crippling as- sumption— by combining close attention to the world, in all its precar- ity, with questions about how wealth is amassed. How might capitalism look without assuming progress? It might look patchy: the concentration of wealth is possible because value produced in unplanned patches is appro- priated for capital.

About ecology: For humanists, assumptions of progressive human mastery have encouraged a view of nature as a romantic space of anti- modernity.4 Yet for twentieth- century scientists, progress also unself- consciously framed the study of landscapes. Assumptions about expansion slipped into the formulation of population biology. New developments in ecology make it possible to think quite differently by introducing cross- species interactions and disturbance histories. In this time of di- minished expectations, I look for disturbance- based ecologies in which many species sometimes live together without either harmony or conquest.

While I refuse to reduce either economy or ecology to the other, there is one connection between economy and environment that seems important to introduce up front: the history of the human concentra- tion of wealth through making both humans and nonhumans into re- sources for investment. This history has inspired investors to imbue both people and things with alienation, that is, the ability to stand alone, as if the entanglements of living did not matter.5 Through alienation, people and things become mobile assets; they can be removed from their life worlds in distance- defying transport to be exchanged with other assets from other life worlds, elsewhere.6 This is quite different from merely using others as part of a life world— for example, in eating and being eaten. In that case, multispecies living spaces remain in place. Alienation obviates living- space entanglement. The dream of alienation inspires landscape modification in which only one stand- alone asset matters;

6 Prologue

everything else becomes weeds or waste. Here, attending to living- space entanglements seems inefficient, and perhaps archaic. When its singular asset can no longer be produced, a place can be abandoned. The timber has been cut; the oil has run out; the plantation soil no longer supports crops. The search for assets resumes elsewhere. Thus, simplification for alienation produces ruins, spaces of abandonment for asset production.

Global landscapes today are strewn with this kind of ruin. Still, these places can be lively despite announcements of their death; aban- doned asset fields sometimes yield new multispecies and multicultural life. In a global state of precarity, we don’t have choices other than look- ing for life in this ruin.

Our first step is to bring back curiosity. Unencumbered by the sim- plifications of progress narratives, the knots and pulses of patchiness are there to explore. Matsutake are a place to begin: However much I learn, they take me by surprise.

This is not a book about Japan, but the reader needs to know something about matsutake in Japan to proceed.7 Matsutake first appears in Japan’s written record in the eighth- century poem that starts this prologue. Al- ready then, the mushroom is praised for its aromatic marking of the autumn season. The mushroom became common around Nara and Kyoto, where people had deforested the mountains for wood to build temples and to fuel iron forges. Indeed, human disturbance allowed Tricholoma matsutake to emerge in Japan. This is because its most com- mon host is red pine (Pinus densiflora), which germinates in the sunlight and mineral soils left by human deforestation. When forests in Japan are allowed to grow back, without human disturbance, broadleaf trees shade out pines, preventing their further germination.

As red pine spread with deforestation across Japan, matsutake be- came a valued gift, presented beautifully in a box of ferns. Aristocrats were honored by it. By the Edo period (1603– 1868), well- to- do common- ers, such as urban merchants, also enjoyed matsutake. The mushroom joined the celebration of the four seasons as a marker of autumn. Out- ings to pick matsutake in the fall were an equivalent of cherry- blossom

autumn aroma 7

viewing parties in the spring. Matsutake became a popular subject for poetry.

The sound of a temple bell is heard in the cedar forest at dusk, The autumn aroma drifts on the roads below.

— AkemI TAchIbAnA (1812– 1868)8

As in other Japanese nature poetry, seasonal referents helped build a mood. Matsutake joined older signs of the fall season, such as the sound of deer crying or the harvest moon. The coming bareness of winter touched autumn with an incipient loneliness, at the edge of nostalgia, and the poem above offers that mood. Matsutake was an elite pleasure, a sign of the privilege to live within the artful reconstruction of nature for refined tastes.9 For this reason, when peasants preparing for elite outings sometimes “planted” matsutake (i.e., stuck mushrooms artfully in the ground because naturally occurring matsutake were not avail- able), no one objected. Matsutake had become an element of an ideal seasonality, appreciated not only in poetry but also in all the arts, from tea ceremony to theater.

The moving cloud fades away, and I smell the aroma of the mushroom.

— KoI NAgAtA (1900– 1997)10

The Edo period was ended by the Meiji Restoration— and Japan’s rapid modernization. Deforestation proceeded apace, privileging pine and matsutake. In the Kyoto area, matsutake became a generic term for “mushroom.” In the early twentieth century, matsutake were particu- larly common. In the mid- 1950s, however, the situation began to change. Peasant woodlands were cut down for timber plantations, paved for sub- urban development, or abandoned by peasants moving to the city. Fossil fuel replaced firewood and charcoal; farmers no longer used the remain- ing woodlands, which grew up in dense thickets of broadleaf trees. Hill- sides that had once been covered by matsutake were now too shady for pine ecologies. Shade- stressed pines were killed by an invasive nematode. By the mid- 1970s, matsutake had become rare across Japan.

8 Prologue

This was the time, however, of Japan’s rapid economic development, and matsutake were in demand as exquisitely expensive gifts, perks, and bribes. The price of matsutake skyrocketed. The knowledge that mat- sutake grew in other parts of the world suddenly became relevant. Jap- anese travelers and residents abroad began to send matsutake to Japan; as importers emerged to funnel the international matsutake trade, non- Japanese pickers rushed in. At first it seemed that there were a plethora of colors and kinds that might appropriately be considered matsutake— because they had the smell. Scientific names proliferated as matsutake in forests across the northern hemisphere suddenly rose from neglect. In the past twenty years, names have been consolidated. All across Eur- asia, most matsutake are now Tricholoma matsutake.11 In North America, T. matsutake seems to be found only in the east, and in the mountains of Mexico. In western North America, the local matsutake is considered another species, T. magnivelare.12 Some scientists, however, think the ge- neric term “matsutake” is the best way to identify these aromatic mush- rooms, since the dynamics of speciation are still unclear.13 I follow that practice except where I am discussing questions of classification.

Japanese have figured out ways of ranking matsutake from different parts of the world, and ranks are reflected in prices. My eyes were first opened to such rankings when one Japanese importer explained: “Mat- sutake are like people. American mushrooms are white because the people are white. Chinese mushrooms are black, because the people are black. Japanese people and mushrooms are nicely in between.” Not ev- eryone has the same rankings, but this stark example can stand in for the many forms of classification and valuation that structure the global trade.

Meanwhile, people in Japan worry about the loss of the peasant wood- lands that have been the source of so much seasonal beauty, from spring blossoms to bright autumn leaves. Starting in the 1970s, volunteer groups mobilized to restore these woodlands. Wanting their work to matter beyond passive aesthetics, the groups looked for ways restored wood- lands might benefit human livelihood. The high price of matsutake made it an ideal product of woodland restoration.

And so I return to precarity and living in our messes. But living seems to have gotten more crowded, not only with Japanese aesthetics and eco-

autumn aroma 9

logical histories, but also with international relations and capitalist trad- ing practices. This is the stuff for stories in the book that follows. For the moment, it seems important to appreciate the mushroom.

Oh, matsutake: The excitement before finding them.

— YAmAguchI Sodo (1642– 1716)14

Part I What’s Left?

Conjuring time, Yunnan. Watching

the boss gamble.

It wAS A StIll- brIght evenIng when I reAlIzed I was lost and empty- handed in an unknown forest. I was on my first search for matsutake— and matsutake pickers— in Oregon’s Cascade Mountains. Earlier that afternoon, I had found the Forest Service’s “big camp” for mushroom pickers, but all the pickers were out foraging. I had decided to look for mushrooms myself while I waited for their return.

I couldn’t have imagined a more unpromising- looking forest. The ground was dry and rocky, and nothing grew except thin sticks of lodgepole pine. There were hardly any plants growing near the ground, not even grass, and when I touched the soil, sharp pumice shards cut my fingers. As the afternoon wore on, I found one or two “copper tops,” dingy mushrooms with a splash of orange and a mealy smell.1 Nothing else. Worse yet, I was disoriented. Every way I turned, the forest looked the same. I had no idea which direction to go to find my car. Thinking I would be out there just briefly, I had brought nothing, and I knew I would soon be thirsty, hungry— and cold.

I stumbled around and eventually found a dirt road. But which way should I go? The sun was getting lower as I trudged along. I had walked less than a mile when a pickup truck drew up. A bright- faced young

14 Part i

man and a wizened old man were inside, and they offered me a ride. The young man introduced himself as Kao. Like his uncle, he said, he was a Mien from the hills of Laos who had come to the United States from a refugee camp in Thailand in the 1980s. They were neighbors in Sacramento, California, and here to pick mushrooms together. They brought me to their camp. The young man went to get water, driving his plastic jugs to a water storage container some ways away. The older man did not know English, but it turned out he knew a little Mandarin Chinese, as did I. As we awkwardly exchanged phrases, he pulled out a smoking bong handcrafted from PVC pipe and lit up his tobacco.

It was dusk when Kao came back with the water. But he beckoned me to go picking with him: There were mushrooms nearby. In the gath- ering dark, we scrambled up a rocky hillside not far from his camp. I saw nothing but dirt and some scrawny pine trees. But here was Kao with his bucket and stick, poking deep into clearly empty ground and pulling up a fat button. How could this be possible? There had been nothing there— and then there it was.

Kao handed me the mushroom. That’s when I first experienced the smell. It’s not an easy smell. It’s not like a flower or a mouth- watering food. It’s disturbing. Many people never learn to love it. It’s hard to de- scribe. Some people liken it to rotting things and some to clear beauty— the autumn aroma. At my first whiff, I was just . . . astonished.

My surprise was not just for the smell. What were Mien tribesmen, Japanese gourmet mushrooms, and I doing in a ruined Oregon indus- trial forest? I had lived in the United States for a long time without ever hearing about any of these things. The Mien camp pulled me back to my earlier fieldwork in Southeast Asia; the mushroom tickled my inter- est in Japanese aesthetics and cuisine. The broken forest, in contrast, seemed like a science fiction nightmare. To my faulty common sense, we all seemed miraculously out of time and out of place— like some- thing that might jump out of a fairy tale. I was startled and intrigued; I couldn’t stop exploring. This book is my attempt to pull you into the maze I found.

1 Arts of Noticing

I am not proposing a return to the Stone Age. My intent is not reactionary, nor even conservative, but simply subversive. It seems that the utopian imagination is trapped, like capitalism and industrialism and the human population, in a one- way future consisting only of growth. All I’m trying to do is figure out how to put a pig on the tracks.

— Ursula K. Le Guin

In 1908 And 1909 two rAIlroAd entrePreneurS raced each other to build track along Oregon’s Deschutes River.1 The goal of each was to be the first to create an industrial connection be- tween the towering ponderosas of the eastern Cascades and the stacked lumberyards of Portland. In 1910, the thrill of competition yielded to an agreement for joint service. Pine logs poured out of the region, bound for distant markets. Lumber mills brought new settlers; towns sprung

Conjuring time, Kyoto Prefecture.

Mr. Imoto’s map of revitalizing. This is his matsutake mountain:

a time machine of multiple seasons,

histories, and hopes.

18 ChaPter 1

up as millworkers multiplied. By the 1930s, Oregon had become the na- tion’s largest producer of timber.

This is a story we know. It is the story of pioneers, progress, and the trans- formation of “empty” spaces into industrial resource fields.

In 1989, a plastic spotted owl was hung in effigy on an Oregon log- ging truck.2 Environmentalists had shown that unsustainable logging was destroying Pacific Northwest forests. “The spotted owl was like the canary in the coal mine,” explained one advocate. “It was . . . symbolic of an ecosystem on the verge of collapse.”3 When a federal judge blocked old- growth logging to save owl habitat, loggers were furious; but how many loggers were there? Logging jobs had dwindled as timber compa- nies mechanized— and as prime timber disappeared. By 1989, many mills had already closed; logging companies were moving to other re- gions.4 The eastern Cascades, once a hub of timber wealth, were now cutover forests and former mill towns overgrown by brush.

This is a story we need to know. Industrial transformation turned out to be a bubble of promise followed by lost livelihoods and damaged landscapes. And yet: such documents are not enough. If we end the story with decay, we abandon all hope— or turn our attention to other sites of promise and ruin, promise and ruin.

What emerges in damaged landscapes, beyond the call of industrial promise and ruin? By 1989, something else had begun in Oregon’s cut- over forests: the wild mushroom trade. From the first it was linked to worldwide ruination: The 1986 Chernobyl disaster had contaminated Europe’s mushrooms, and traders had come to the Pacific Northwest for supplies. When Japan began importing matsutake at high prices— just as jobless Indochinese refugees were settling in California— the trade went wild. Thousands rushed to Pacific Northwest forests for the new “white gold.” This was in the middle of a “jobs versus the environ- ment” battle over the forests, yet neither side noticed the mushroomers. Job advocates imagined only wage contracts for healthy white men; the foragers— disabled white veterans, Asian refugees, Native Americans, and undocumented Latinos— were invisible interlopers. Conservation- ists were fighting to keep human disturbance out of the forests; the entry of thousands of people, had it been noticed, would hardly have been welcome. But the mushroom hunters were mainly not noticed. At

arts of notiCing 19

most, the Asian presence sparked local fears of invasion: journalists wor- ried about violence.5

A few years into the new century, the idea of a trade- off between jobs and the environment seemed less convincing. With or without conservation, there were fewer “jobs” in the twentieth- century sense in the United States; besides, it seemed much more likely that environ- mental damage would kill all of us off, jobs or no jobs. We are stuck with the problem of living despite economic and ecological ruination. Neither tales of progress nor of ruin tell us how to think about collabo- rative survival. It is time to pay attention to mushroom picking. Not that this will save us— but it might open our imaginations.

Geologists have begun to call our time the Anthropocene, the epoch in which human disturbance outranks other geological forces. As I write, the term is still new— and still full of promising contradictions. Thus, although some interpreters see the name as implying the triumph of humans, the opposite seems more accurate: without planning or inten- tion, humans have made a mess of our planet.6 Furthermore, despite the prefix “anthropo- ,” that is, human, the mess is not a result of our species biology. The most convincing Anthropocene time line begins not with our species but rather with the advent of modern capitalism, which has directed long- distance destruction of landscapes and ecologies. This time line, however, makes the “anthropo- ” even more of a problem. Imagin- ing the human since the rise of capitalism entangles us with ideas of progress and with the spread of techniques of alienation that turn both humans and other beings into resources. Such techniques have segre- gated humans and policed identities, obscuring collaborative survival. The concept of the Anthropocene both evokes this bundle of aspira- tions, which one might call the modern human conceit, and raises the hope that we might muddle beyond it. Can we live inside this regime of the human and still exceed it?

This is the predicament that makes me pause before offering a de- scription of mushrooms and mushroom pickers. The modern human conceit won’t let a description be anything more than a decorative

20 ChaPter 1

footnote. This “anthropo- ” blocks attention to patchy landscapes, mul- tiple temporalities, and shifting assemblages of humans and nonhu- mans: the very stuff of collaborative survival. In order to make mush- room picking a worthwhile tale, then, I must first chart the work of this “anthropo- ” and explore the terrain it refuses to acknowledge.

Consider, indeed, the question of what’s left. Given the effectiveness of state and capitalist devastation of natural landscapes, we might ask why anything outside their plans is alive today. To address this, we will need to watch unruly edges. What brings Mien and matsutake together in Oregon? Such seemingly trivial queries might turn everything around to put unpredictable encounters at the center of things.

We hear about precarity in the news every day. People lose their jobs or get angry because they never had them. Gorillas and river porpoises hover at the edge of extinction. Rising seas swamp whole Pacific islands. But most of the time we imagine such precarity to be an exception to how the world works. It’s what “drops out” from the system. What if, as I’m suggesting, precarity is the condition of our time— or, to put it an- other way, what if our time is ripe for sensing precarity? What if precar- ity, indeterminacy, and what we imagine as trivial are the center of the systematicity we seek?

Precarity is the condition of being vulnerable to others. Unpredict- able encounters transform us; we are not in control, even of ourselves. Unable to rely on a stable structure of community, we are thrown into shifting assemblages, which remake us as well as our others. We can’t rely on the status quo; everything is in flux, including our ability to sur- vive. Thinking through precarity changes social analysis. A precarious world is a world without teleology. Indeterminacy, the unplanned na- ture of time, is frightening, but thinking through precarity makes it evident that indeterminacy also makes life possible.

The only reason all this sounds odd is that most of us were raised on dreams of modernization and progress. These frames sort out those parts of the present that might lead to the future. The rest are trivial; they “drop out” of history. I imagine you talking back: “Progress? That’s an idea from the nineteenth century.” The term “progress,” referring to a general state, has become rare; even twentieth- century modernization has begun to feel archaic. But their categories and assumptions of im- provement are with us everywhere. We imagine their objects every day:

arts of notiCing 21

democracy, growth, science, hope. Why would we expect economies to grow and sciences to advance? Even without explicit reference to devel- opment, our theories of history are embroiled in these categories. So, too, are our personal dreams. I’ll admit it’s hard for me to even say this: there might not be a collective happy ending. Then why bother getting up in the morning?

Progress is embedded, too, in widely accepted assumptions about what it means to be human. Even when disguised through other terms, such as “agency,” “consciousness,” and “intention,” we learn over and over that humans are different from the rest of the living world because we look forward— while other species, which live day to day, are thus dependent on us. As long as we imagine that humans are made through progress, nonhumans are stuck within this imaginative framework too.

Progress is a forward march, drawing other kinds of time into its rhythms. Without that driving beat, we might notice other temporal patterns. Each living thing remakes the world through seasonal pulses of growth, lifetime reproductive patterns, and geographies of expan- sion. Within a given species, too, there are multiple time- making projects, as organisms enlist each other and coordinate in making landscapes. (The regrowth of the cutover Cascades and Hiroshima’s radioecology each show us multispecies time making.) The curiosity I advocate fol- lows such multiple temporalities, revitalizing description and imagina- tion. This is not a simple empiricism, in which the world invents its own categories. Instead, agnostic about where we are going, we might look for what has been ignored because it never fit the time line of progress.

Consider again the snippets of Oregon history with which I began this chapter. The first, about railroads, tells of progress. It led to the fu- ture: railroads reshaped our destiny. The second is already an interrup- tion, a history in which the destruction of forests matters. What it shares with the first, however, is the assumption that the trope of progress is sufficient to know the world, both in success and failure. The story of decline offers no leftovers, no excess, nothing that escapes progress. Progress still controls us even in tales of ruination.

Yet the modern human conceit is not the only plan for making worlds: we are surrounded by many world- making projects, human and not human.7 World- making projects emerge from practical activities of

22 ChaPter 1

making lives; in the process these projects alter our planet. To see them, in the shadow of the Anthropocene’s “anthropo- ,” we must reorient our attention. Many preindustrial livelihoods, from foraging to stealing, persist today, and new ones (including commercial mushroom picking) emerge, but we neglect them because they are not a part of progress. These livelihoods make worlds too— and they show us how to look around rather than ahead.

Making worlds is not limited to humans. We know that beavers re- shape streams as they make dams, canals, and lodges; in fact, all organ- isms make ecological living places, altering earth, air, and water. With- out the ability to make workable living arrangements, species would die out. In the process, each organism changes everyone’s world. Bacteria made our oxygen atmosphere, and plants help maintain it. Plants live on land because fungi made soil by digesting rocks. As these examples sug- gest, world- making projects can overlap, allowing room for more than one species. Humans, too, have always been involved in multispecies world making. Fire was a tool for early humans not just to cook but also to burn the landscape, encouraging edible bulbs and grasses that at- tracted animals for hunting. Humans shape multispecies worlds when our living arrangements make room for other species. This is not just a matter of crops, livestock, and pets. Pines, with their associated fungal partners, often flourish in landscapes burned by humans; pines and fungi work together to take advantage of bright open spaces and exposed mineral soils. Humans, pines, and fungi make living arrangements si- multaneously for themselves and for others: multispecies worlds.

Twentieth- century scholarship, advancing the modern human con- ceit, conspired against our ability to notice the divergent, layered, and conjoined projects that make up worlds. Entranced by the expansion of certain ways of life over others, scholars ignored questions of what else was going on. As progress tales lose traction, however, it becomes possi- ble to look differently.

The concept of assemblage is helpful. Ecologists turned to assem- blages to get around the sometimes fixed and bounded connotations of ecological “community.” The question of how the varied species in a species assemblage influence each other— if at all— is never settled: some thwart (or eat) each other; others work together to make life pos- sible; still others just happen to find themselves in the same place. As-

arts of notiCing 23

semblages are open- ended gatherings. They allow us to ask about com- munal effects without assuming them. They show us potential histories in the making. For my purposes, however, I need something other than organisms as the elements that gather. I need to see lifeways— and non- living ways of being as well— coming together. Nonhuman ways of being, like human ones, shift historically. For living things, species identities are a place to begin, but they are not enough: ways of being are emergent effects of encounters. Thinking about humans makes this clear. Foraging for mushrooms is a way of life— but not a common characteristic of all humans. The issue is the same for other species. Pines find mushrooms to help them use human- made open spaces. As- semblages don’t just gather lifeways; they make them. Thinking through assemblage urges us to ask: How do gatherings sometimes become “happenings,” that is, greater than the sum of their parts? If history without progress is indeterminate and multidirectional, might assem- blages show us its possibilities?

Patterns of unintentional coordination develop in assemblages. To notice such patterns means watching the interplay of temporal rhythms and scales in the divergent lifeways that gather. Surprisingly, this turns out to be a method that might revitalize political economy as well as environmental studies. Assemblages drag political economy inside them, and not just for humans. Plantation crops have lives different from those of their free- living siblings; cart horses and hunter steeds share species but not lifeways. Assemblages cannot hide from capital and the state; they are sites for watching how political economy works. If capi- talism has no teleology, we need to see what comes together— not just by prefabrication, but also by juxtaposition.

Other authors use “assemblage” with other meanings.8 The qualifier “polyphonic” may help explain my variant. Polyphony is music in which autonomous melodies intertwine. In Western music, the madrigal and the fugue are examples of polyphony. These forms seem archaic and strange to many modern listeners because they were superseded by music in which a unified rhythm and melody holds the composition together. In the classical music that displaced baroque, unity was the goal; this was “progress” in just the meaning I have been discussing: a unified coordination of time. In twentieth- century rock- and- roll, this unity takes the form of a strong beat, suggestive of the listener’s heart;

24 ChaPter 1

we are used to hearing music with a single perspective. When I first learned polyphony, it was a revelation in listening; I was forced to pick out separate, simultaneous melodies and to listen for the moments of harmony and dissonance they created together. This kind of noticing is just what is needed to appreciate the multiple temporal rhythms and trajectories of the assemblage.

For those not musically inclined, it may be useful to imagine the polyphonic assemblage in relation to agriculture. Since the time of the plantation, commercial agriculture has aimed to segregate a single crop and work toward its simultaneous ripening for a coordinated harvest. But other kinds of farming have multiple rhythms. In the shifting culti- vation I studied in Indonesian Borneo, many crops grew together in the same field, and they had quite different schedules. Rice, bananas, taro, sweet potatoes, sugarcane, palms, and fruit trees mingled; farmers needed to attend to the varied schedules of maturation of each of these crops. These rhythms were their relation to human harvests; if we add other relations, for example, to pollinators or other plants, rhythms multiply. The polyphonic assemblage is the gathering of these rhythms, as they result from world- making projects, human and not human.

The polyphonic assemblage also moves us into the unexplored terri- tory of the modern political economy. Factory labor is an exemplar of coordinated progress time. Yet the supply chain is infused with poly- phonic rhythms. Consider the tiny Chinese garment factory studied by Nellie Chu; like its many competitors, it served multiple supply lines, constantly switching among orders for local boutique brands, knock- off international brands, and generic to- be- branded- later production.9 Each required different standards, materials, and kinds of labor. The factory’s job was to match industrial coordination to the complex rhythms of supply chains. Rhythms further multiply when we move out of facto- ries to watch foraging for an unpredictable wild product. The farther we stray into the peripheries of capitalist production, the more coordi- nation between polyphonic assemblages and industrial processes be- comes central to making a profit.

As the last examples suggest, abandoning progress rhythms to watch polyphonic assemblages is not a matter of virtuous desire. Progress felt great; there was always something better ahead. Progress gave us the “progressive” political causes with which I grew up. I hardly know how

arts of notiCing 25

to think about justice without progress. The problem is that progress stopped making sense. More and more of us looked up one day and re- alized that the emperor had no clothes. It is in this dilemma that new tools for noticing seem so important.10 Indeed, life on earth seems at stake. Chapter 2 turns to dilemmas of collaborative survival.

Interlude Tracking

MuShroom trAckS Are eluSIve And enIgmAtIc; following them takes me on a wild ride— trespassing every boundary. Things get even stranger when I move out of commerce into Darwin’s “entangled bank” of multiple life forms.1 Here, the biology we thought we knew stands on its head. Entanglement bursts categories and upends identities.

Mushrooms are the fruiting bodies of fungi. Fungi are diverse and often flexible, and they live in many places, ranging from ocean cur- rents to toenails. But many fungi live in the soil, where their thread- like filaments, called hyphae, spread into fans and tangle into cords through the dirt. If you could make the soil liquid and transparent and walk into the ground, you would find yourself surrounded by nets of fungal hy- phae. Follow fungi into that underground city, and you will find the strange and varied pleasures of interspecies life.2

Many people think fungi are plants, but they are actually closer to animals. Fungi do not make their food from sunlight, as plants do. Like animals, fungi must find something to eat. Yet fungal eating is often gen- erous: It makes worlds for others. This is because fungi have extracellular

Elusive life, Oregon. The spoor of deer and elk lead pickers to matsutake

patches. There, cracks signal a deep- seated

mushroom rising through the ground. Tracking

means following worldly entanglements.

138 interlude

digestion. They excrete digestive acids outside their bodies to break down their food into nutrients. It’s as if they had everted stomachs, di- gesting food outside instead of inside their bodies. Nutrients are then absorbed into their cells, allowing the fungal body to grow— but also other species’ bodies. The reason there are plants growing on dry land (rather than just in water) is that over the course of the earth’s history fungi have digested rocks, making nutrients available for plants. Fungi (together with bacteria) made the soil in which plants grow. Fungi also digest wood. Otherwise, dead trees would stack up in the forest forever. Fungi break them down into nutrients that can be recycled into new life. Fungi are thus world builders, shaping environments for themselves and others.

Some fungi have learned to live in intimate associations with plants, and given enough time to adjust to the interspecies relations of a place, most plants enter into associations with fungi. “Endophytic” and “endo- mycorrhizal” fungi live inside plants. Many do not have fruiting bodies; they gave up sex millions of years ago. We are likely never to see these fungi unless we peer inside plants with microscopes, yet most plants are thick with them. “Ectomycorrhizal” fungi wrap themselves around the outsides of roots as well as penetrating between their cells. Many of the favorite mushrooms of people around the world— porcini, chanterelles, truffles, and, indeed, matsutake— are the fruiting bodies of ectomycor- rhizal plant associates. They are so delicious, and so difficult for humans to manipulate, because they thrive together with host trees. They come into being only through interspecies relations.

The term “mycorrhiza” is assembled from Greek words for “fungus” and “root”; fungi and plant roots become intimately entangled in my- corrhizal relations. Neither the fungus nor the plant can flourish with- out the activity of the other. From the fungal perspective, the goal is to get a good meal. The fungus extends its body into the host’s roots to siphon off some of the plant’s carbohydrates through specialized inter- face structures, made in the encounter. The fungus depends on this food, yet it is not entirely selfish. Fungi stimulate plant growth, first, by get- ting plants more water, and, second, by making the nutrients of extra- cellular digestion available to plants. Plants get calcium, nitrogen, po- tassium, phosphorus, and other minerals through mycorrhiza. Forests, according to researcher Lisa Curran, occur only because of ectomycor-

traCking 139

rhizal fungi.3 By leaning on fungal companions, trees grow strong and numerous, making forests.

Mutual benefits do not lead to perfect harmony. Sometimes the fun- gus parasitizes the root in one phase of its life cycle. Or, if the plant has lots of nutrients, it may reject the fungus. A mycorrhizal fungus with- out a plant collaborator will die. But many ectomycorrhizas are not lim- ited to one collaboration; the fungus forms a network across plants. In a forest, fungi connect not just trees of the same species, but often many species. If you cover a tree in the forest, depriving its leaves of light and thus food, its mycorrhizal associates may feed it from the carbohydrates of other trees in the network.4 Some commentators compare mycorrhi- zal networks to the Internet, writing of the “woodwide web.” Mycorrhi- zas form an infrastructure of interspecies interconnection, carrying in- formation across the forest. They also have some of the characteristics of a highway system. Soil microbes that would otherwise stay in the same place are able to travel in the channels and linkages of mycorrhi- zal interconnection. Some of these microbes are important for environ- mental remediation.5 Mycorrhizal networks allow forests to respond to threats.

Why has the world- building work of fungi received so little appreci- ation? Partly, this is because people can’t venture underground to see the amazing architecture of the underground city. But it is also because until quite recently many people— perhaps especially scientists—imag- ined life as a matter of species- by- species reproduction. The most im- portant interspecies interactions, in this worldview, were predator- prey relations in which interaction meant wiping each other out. Mutualistic relations were interesting anomalies, but not really necessary to under- stand life. Life emerged from the self- replication of each species, which faced evolutionary and environmental challenges on its own. No spe- cies needed another for its continuing vitality; it organized itself. This self- creation marching band drowned out the stories of the under- ground city. To recover those underground stories, we might reconsider the species- by- species worldview, and the new evidence that has begun to transform it.

When Charles Darwin proposed a theory of evolution through nat- ural selection in the nineteenth century, he had no explanation for her- itability. Only the recovery in 1900 of Gregor Mendel’s work on genetics

140 interlude

suggested a mechanism by which natural selection could produce its effects. In the twentieth century, biologists combined genetics and evo- lution and created the “modern synthesis,” a powerful story about how species come into being through genetic differentiation. The early- twentieth- century discovery of chromosomes, structures within cells that carry genetic information, gave palpability to the story. Units of heredity—genes— were located on chromosomes. In sexually reproduc- ing vertebrates, a special line of “germ cells” was found to conserve the chromosomes that give rise to the next generation. (Human sperm and eggs are germ cells.) Changes in the rest of the body— even genetic changes—should not be transmitted to offspring as long as they do not affect the germ cells’ chromosomes. Thus the self- replication of the spe- cies would be protected from the vicissitudes of ecological encounter and history. As long as the germ cells were unaffected, the organism would remake itself, extending species continuity.

This is the heart of the species self- creation story: Species reproduc- tion is self- contained, self- organized, and removed from history. To call this the “modern synthesis” is quite right in relation to the questions of modernity that I discussed in terms of scalability. Self- replicating things are models of the kind of nature that technical prowess can control: they are modern things. They are interchangeable with each other, because their variability is contained by their self- creation. Thus, they are also scalable. Inheritable traits are expressed at multiple scales: cells, organs, organisms, populations of interbreeding individuals, and, of course, the species itself. Each of these scales is another expression of self- enclosed genetic inheritance, and thus they are neatly nested and scalable. As long as they are all expressions of the same traits, research can move back and forth across these scales without friction. Some hint of coming problems appeared in this paradigm’s excesses: when researchers took scalability literally, they produced bizarre new stories of the gene in charge of ev- erything. Genes for criminality and creativity were proposed, sliding freely across scales from chromosome to social world. “The selfish gene,” in charge of evolution, required no collaborators. Scalable life, in these versions, captured genetic inheritance in a self- enclosed and self- replicating modernity, indeed, Max Weber’s iron cage.

The discovery of the stability and self- replicating properties of DNA in the 1950s was the jewel in the crown of the modern synthesis— but

traCking 141

also the opening to its undoing. DNA, with associated proteins, is the material of chromosomes. The chemical structure of its double helix strands is both stable and, amazingly, able to replicate exactly on a newly built strand. What a model for self- contained replication! The replication of DNA was mesmerizing; it formed an icon for modern sci- ence itself, which requires the replication of results, and thus research objects that are stable and interchangeable across experimental itera- tions, that is, without history. The results of the replication of DNA can be tracked at every biological scale (protein, cell, organ, organism, pop- ulation, species). Biological scalability was given a mechanism, strength- ening the story of thoroughly modern life— life ruled by gene expres- sion and isolated from history.

Yet DNA research has led in unexpected directions. Consider the trajectory of evolutionary developmental biology. This field was one of the many that emerged from the DNA revolution; it studies genetic mu- tation and expression in the development of organisms, and the impli- cations of this for speciation. In studying development, however, re- searchers could not avoid the history of encounters between an organism and its environment. They found themselves in conversation with ecol- ogists, and suddenly they realized they had evidence for a type of evolu- tion that had not been expected by the modern synthesis. In contrast to the modern orthodoxy, they found that many kinds of environmental effects could be passed on to offspring, through a variety of mecha- nisms, some affecting gene expression and others influencing the fre- quency of mutations or the dominance of varietal forms.6

One of their most surprising findings was that many organisms de- velop only through interactions with other species. A tiny Hawaiian squid, Euprymna scolopes, has become a model for thinking about this process.7 The “bob- tailed squid” is known for its light organ, through which it mimics moonlight, hiding its shadow from predators. But juve- nile squid do not develop this organ unless they come into contact with one particular species of bacteria, Vibrio fischeri. The squid are not born with these bacteria; they must encounter them in the seawater. Without them, the light organ never develops. But perhaps you think light organs are superfluous. Consider the parasitic wasp Asobara tabida. Females are completely unable to produce eggs without bacteria of the genus Wolba- chia.8 Meanwhile, larvae of the Large Blue butterfly Maculinea arion are

142 interlude

unable to survive without being taken in by an ant colony.9 Even we proudly independent humans are unable to digest our food without helpful bacteria, first gained as we slide out of the birth canal. Ninety percent of the cells in a human body are bacteria. We can’t do without them.10

As biologist Scott Gilbert and his colleagues write, “Almost all devel- opment may be codevelopment. By codevelopment we refer to the abil- ity of the cells of one species to assist the normal construction of the body of another species.”11 This insight changes the unit of evolution. Some biologists have begun to speak of the “hologenome theory of evo- lution,” referring to the complex of organisms and their symbionts as an evolutionary unit: the “holobiont.”12 They find, for example, that associ- ations between particular bacteria and fruit flies influence fruit fly mat- ing choice, thus shaping the road to the development of a new species.13 To add the importance of development, Gilbert and his colleagues use the term “symbiopoiesis,” the codevelopment of the holobiont. The term contrasts their findings with an earlier focus on life as internally self- organizing systems, self- formed through “autopoiesis.” “More and more,” they write, “symbiosis appears to be the ‘rule,’ not the excep- tion. . . . Nature may be selecting ‘relationships’ rather than individuals or genomes.”14

Interspecies relations draw evolution back into history because they depend on the contingencies of encounter. They do not form an inter- nally self- replicating system. Instead, interspecies encounters are always events, “things that happen,” the units of history. Events can lead to rel- atively stable situations, but they cannot be counted on in the way self- replicating units can; they are always framed by contingency and time. History plays havoc with scalability. The only way to create scalability is to repress change and encounter. If they can’t be repressed, the whole relation across scales must be rethought. When British conservationists tried to save the Large Blue butterfly, mentioned above, they could not assume that a mating population could by itself reproduce the species, although, according to the modern synthesis, populations are formed from individuals formed by genes. They could not leave out the ants without which the larvae cannot survive.15 Large Blue butterfly popula- tions are thus not a scalable effect of the butterflies’ DNA. They are non- scalable sites of interspecies encounter. This is a problem for the mod-

traCking 143

ern synthesis, because population genetics was from the early twentieth century at the core of evolution- without- history. Might population sci- ence need to step aside for an emergent multispecies historical ecology? Might the arts of noticing I discuss be at its core?16

Reintroducing history into evolutionary thinking has already begun at other biological scales. The cell, once an emblem of replicable units, turns out to be the historical product of symbiosis among free- living bacteria.17 Even DNA turns out to have more history in its amino- acid sequences than once thought. Human DNA is part virus; viral encoun- ters mark historical moments in making us human.18 Genome research has taken up the challenge of identifying encounter in the making of DNA. Population science cannot avoid history for much longer.19

Fungi are ideal guides. Fungi have always been recalcitrant to the iron cage of self- replication. Like bacteria, some are given to exchanging genes in nonreproductive encounters (“horizontal gene transfer”); many also seem averse to keeping their genetic material sorted out as “individ- uals” and “species,” not to speak of “populations.” When researchers studied the fruiting bodies of what they thought of as a species, the ex- pensive Tibetan “caterpillar fungus,” they found many species entan- gled together.20 When they looked into the filaments of Armillaria root rot, they found genetic mosaics that confused the identification of an individual.21 Meanwhile, fungi are famous for their symbiotic attach- ments. Lichen are fungi living together with algae and cyanobacteria. I have been discussing fungal collaborations with plants, but fungi live with animals as well. For example, Macrotermes termites digest their food only through the help of fungi. The termites chew up wood, but they cannot digest it. Instead, they build “fungus gardens” in which the chewed- up wood is digested by Termitomyces fungi, producing edible nutrients. Researcher Scott Turner points out that, while you might say that the termites farm the fungus, you could equally say that the fungus farms the termites. Termitomyces uses the environment of the termite mound to outcompete other fungi; meanwhile, the fungus regulates the mound, keeping it open, by throwing up mushrooms annually, cre- ating a colony- saving disturbance in termite mound- building.22

Our metaphorical language (here termite “farming”) sometimes gets in the way and sometimes throws up unexpected insights. One of the most common metaphors in talk of symbiosis is “outsourcing.” You

144 interlude

could say the termites outsource their digestion to fungi, or, alterna- tively, that the fungi outsource food gathering and niche building to termites. There are lots of things wrong with comparing biological pro- cesses to contemporary business arrangements, too many, indeed, to catalogue. But perhaps there is one insight here. As in capitalist supply chains, these chains of engagement are not scalable. Their components cannot be reduced to self- replicating interchangeable objects, whether firms or species. Instead, they require attention to the histories of en- counter that maintain the chain. Natural history description, rather than mathematical modeling, is the necessary first step— as in the econ- omy. Radical curiosity beckons. Perhaps an anthropologist, trained in one of the few remaining sciences that values observation and descrip- tion, might come in handy.

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

SCI 115: Intro To Biology Week 10 Discuss

Keystone Species, Shrinking Red Knots, and Biomes”

Our focus this week is on ecology.  Ecology is the study of interactions among organisms and between organisms and their physical environments. For your primary post, respond to one of the following three topics. Also, reply to at least one fellow student on any topic.

Topic 1

:  Keystone Species. Watch the video entitled “Some animals are more equal than others
” (1)* Then completely describe the concept of a keystone species, giving specific examples from the video.

Topic 2 [articles]: Shrinking Red Knots. Read two of the following three articles about shrinking Red Knots (2)*, (3)*, (4)*, or research additional information on your own. Then, address the following issues:

  • (a) Explain how the lifecycle of the Red Knot depends on hatchlings emerging at the same time as the insects hatch.
  • (b) What are the long-term ramifications of having a mismatch between the bird hatch and the insect hatch?
  • (c) Of the two articles you read, which of them do you feel was most informative?  Why?

Topic 3 [research]: Biomes. The term “biome” is described in the textbook. For this topic, describe the biome where you grew up (or where you currently live). Identify your location, the biome of the region, and describe the major characteristics of that biome. Add enough detail and commentary from your own experience. If you’re really ambitious, you could consider looking up the EPA “ecoregion,” which will give additional details about your region.

*References (in Strayer Writing Standards format).

  1. HHMI Biointeractive, May 3, 2016, Some animals are more equal than others: keystone species and trophic cascades., https://www.youtube.com/watch?time_continue=1142&v=hRGg5it5FMI
  2. Briggs, H. (2016, May 12). Shrinking bird pays the bill for Arctic warming. Retrieved from: http://www.bbc.com/news/science-environment-36266692
  3. Dussault, J. (2016, May 12). Climate change chould be shrinking these arctic birds. The Christian Science Monitor. Retrieved from: http://www.csmonitor.com/Science/2016/0512/Climate-change-could-be-shrinking-these-Arctic-birds
  4. Zimmer, C. (2016, May 12). Climate change and the case of the shrinking red knots,. The New York Times. Retrieved from: http://www.nytimes.com/2016/05/17/science/climate-change-bird-red-knots.html?_r=0
 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Proving Your Innocence!

Activity 8: Proving Your Innocence!

You have been accused of committing murder 


A 1:54am on March 10, 2019 police officers responded to a call that resulted in the discovery of one deceased male. Two witnesses identified you and your parent as suspicious individuals and you both have been charged with the murder. The police have collected DNA evidence from the crime scene and from both of you, and they claim that they have DNA proof that you are murderer! You maintain your innocence and will do everything that you can to bring the true criminal to justice.

Below are nucleotide sequences from your and your parent’s DNA at four STR sites. Determine the number of STRs (short tandem repeats) in the chromosomes for both of you. Look for the sequence “GATA”, and if it is repeated, then count and note the number of repeats. Those numbers have been filled in for you, but you will need to find repeats later on.

 

YOUR CHROMOSOMES:

STR Site 1:

TCTTATGGCAAAACCGATGGACTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAATGTTTCGGGTAGCACCAGGAGTCTGTAGCACGTGCATCTCAACGTGGCGTGCGTACACGGTACG How may STRs? 11

 

STR Site 2:

CTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATCGGTAGGGAGACCGAGAATCTATGATAGATAGATAGATAGATAGATACAACTTTCCAAACACCCCGTGTCGTC How may STRs? 6

 

STR Site 3:

GATTACCTCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAAGGATGAGTGTCAGCCA

How may STRs? 27

 

STR Site 4:

CTATTGTACTAATCGGCTTCAACGAGCCGTACAGGTGGCACCTCAGGAGGGGCCCGCAGGGAGGAAGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAACT How may STRs? 15

 

YOUR PARENT’S CHROMOSOMES:

STR Site 1:

GCCGTGTAATGATAGATAGATAGATAGATAGATAGATAGATAGATAACAACCACACCTTAGCGAATTGATGCGCCGCTTCGGAATACCGTTTTGGCTACCCGTTACTAAGCCCATCGCGATTTTCAGGTATCGT

How may STRs? 9

 

STR Site 2:

CTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATCGGTAGGGAGACCGAGAATCTATGATAGATAGATAGATAGATAGATACAACTTTCCAAACACCCCGTGTCGTC How may STRs? 6

 

STR Site 3:

GATTACCTCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAAGGATGAGTGTCAGCCA

How may STRs? 27

 

STR Site 4:

CCGGAATCAGTGACTTTGACAGGTTTGTGGGGTACAGCAATGAGATAGATAGATACTTGCATAGCTGCGTATGGAGGAAGGAACTCTTGCGTGTTAGTATGTTGACCCCTGTATTACGGATGCGGGTAGAAGA

How may STRs? 3

 

1. Using the values given above, fill in the following table:

  STR Site 1 STR Site 2 STR Site 3 STR Site 4
You        
Your Parent        

 

2. After identifying the STRs in the chromosomes, the police forensic team will need to make copies of the repeated regions in order to use for further DNA analysis. What is the method called in which you “amplify” or replicate DNA in a test tube?

 

 

 

3. After the DNA has been amplified, the forensic team uses gel electrophoresis in order to compare DNA samples. In the gel below, you will find that the crime scene DNA has already been analyzed and plotted along the left side of the gel. Using the numbers of STRs that you determined above, mark the positions of each STR in the gel for you and your parent. (Leave the right two columns blank – you will fill them in later.)

 

4. Based on the gel electrophoresis analysis above, were the police correct that you are in fact the murderer? Why or why not?

 

You maintain your innocence, and through good old-fashioned detective work you are able to identify two additional suspects who were recently arrested breaking into a nearby Circle-K: Theodore Logan and William S. Preston, Esquire. You are able to isolate their DNA from saliva on soda straws.

5. Determine the numbers of STRs at sites 3 &4 for William and Theodore. Note that the numbers of STRs have already been found for their first two sites. Again, look for the repeated sequence of “GATA”. (Hint: use the “Find”/ “Search” function to locate sequence easily.)

 

WILLIAM’S CHROMOSOMES:

STR Site 1:

CGCTTATGGTCCATAGCACATTCATCGCATCCGGGCGTGCTCTATTTGACGATCCCTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACC How may STRs? 19

 

STR Site 2:

CACTCTATTGAGGCATTAACGATAGATAGATAGATAGATAGATAGGAAGGAGATCTGGAATGAACTGGCCTATGTCACAGAAACTGTGCAAATACCCAATGTCGTTAGTGTAGGTTCTGACCCGCACTCTATTG

How may STRs? 6

 

STR Site 3:

TTTACAACTGGGGACATAAACCCTACGCCCATCATCTACTGACGTCCCTGAGGCTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACCAGTTCATGTAATGGGAGAGTATCCGCCGCAAGA

How may STRs?

 

STR Site 4:

GCGACACGGGTAGGATCATCAGTAATAAGAGTAGTGGGAAAGCTCACAGACCACCGCCTATAGGGGGTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAGCG

How may STRs?

 

THEODORE’S CHROMOSOMES:

STR Site 1:

CGGTCGATCCGGAGGGACGGGCCTCAAAGCCGCGTCACGACCGGAGTAAGCTCCCGTGGGCCTGGATAGATAGATAGATAGATAGATAGATAGATAGAACAGCCCTGGTGGGCCCCATCAGCAGCCCGAA

How may STRs? 8

 

STR Site 2:

CGCTTTTCGGGACGCGGGCCGAGGGGCGATGCCTTCCACTAATCGAGGCCGTTCGTTAATACTTGGATAGATAGATAGATAGATAGATATTGCGTTCCTAGCGCCTATATTTGTCTCTTTGCCGGCTTATGTG

How may STRs? 6

 

STR Site 3:

TCGGAGCGCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACTCGGTACACGGTATGAGCAGGCGC How may STRs?

 

STR Site 4:

ATTTAATCTGGCTGAGGTGTAGACGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAATTCCAGGCGGTGCGTCTGCTGTCGGGTCCCTCTGGTGACTGGCTAGATGGACTTGCC

How may STRs?

 

6. Using the values given above, fill in the following table:

  STR Site 1 STR Site 2 STR Site 3 STR Site 4
William        
Theodore        

 

7. Plot the results of your DNA profiles for William and Theodore in the two right columns on the gel in Question 3. Are either of them a match for the DNA at the crime scene, and if so, who?

 

8. Why do you think that it is important to consider multiple STR sites when constructing a DNA profile? (Think about what would happen if the police only looked at STR Site 2.)

 

 

 

25 nucleotides

Crime Scene DNA

Your DNA

Parnent’s DNA

20 nucleotides

15 nucleotides

10 nucleotides

5 nucleotides

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"