MICRO BIOLOGY

/in /by

PART A

Hepatitis C is a chronic liver infection that can be either silent (with no noticeable symptoms) or debilitating. Either way, 80% of infected persons experience continuing liver destruction. Chronic hepatitis C infection is the leading cause of liver transplants in the United States. The virus that causes it is blood borne, and therefore patients who undergo frequent procedures involving transfer of blood are particularly susceptible to infection. Kidney dialysis patients belong to this group. In 2008, a for-profit hemodialysis facility in New York was shut down after nine of its patients were confirmed as having become infected with hepatitis C while undergoing hemodialysis treatments there between 2001 and 2008.

When the investigation was conducted in 2008, investigators found that 20 of the facility’s 162 patients had been documented with hepatitis C infection at the time they began their association with the clinic. All the current patients were then offered hepatitis C testing, to determine how many had acquired hepatitis C during the time they were receiving treatment at the clinic. They were considered positive if enzyme-linked immunosorbent assay (ELISA) tests showed the presence of antibodies to the hepatitis C virus.

Health officials did not test the workers at the hemodialysis facility for hepatitis C because they did not view them as likely sources of the nine new infections. Why not?

Why do you think patients were tested for antibody to the virus instead of for the presence of the virus itself?

Ref.: Cowan, M. K. (2014) (4th Ed.). Microbiology: A Systems Approach, McGraw Hill

PART B

Summary:

Directions for the students: There are 4 essay questions. Please be sure to complete all of them with thorough substantive responses. Current APA Citations are required for all responses.

1. Precisely what is microbial death?

2. Why does a population of microbes not die instantaneously when exposed to an antimicrobial agent?

3. Explain what is wrong with this statement: “Prior to vaccination, the patient’s skin was sterilized with alcohol.” What would be a more correct wording?

4. Conduct additional research on the use of triclosan and other chemical agents in antimicrobial products today. Develop an opinion on whether this process should continue, providing evidence and citations to support your stance.

PART A

Hepatitis C is a chronic liver infection that can be either silent (with no noticeable symptoms) or debilitating. Either way, 80% of infected persons experience continuing liver destruction. Chronic hepatitis C infection is the leading cause of liver transplants in the United States. The virus that causes it is blood borne, and therefore patients who undergo frequent procedures involving transfer of blood are particularly susceptible to infection. Kidney dialysis patients belong to this group. In 2008, a for-profit hemodialysis facility in New York was shut down after nine of its patients were confirmed as having become infected with hepatitis C while undergoing hemodialysis treatments there between 2001 and 2008.

When the investigation was conducted in 2008, investigators found that 20 of the facility’s 162 patients had been documented with hepatitis C infection at the time they began their association with the clinic. All the current patients were then offered hepatitis C testing, to determine how many had acquired hepatitis C during the time they were receiving treatment at the clinic. They were considered positive if enzyme-linked immunosorbent assay (ELISA) tests showed the presence of antibodies to the hepatitis C virus.

Health officials did not test the workers at the hemodialysis facility for hepatitis C because they did not view them as likely sources of the nine new infections. Why not?

Why do you think patients were tested for antibody to the virus instead of for the presence of the virus itself?

Ref.: Cowan, M. K. (2014) (4th Ed.). Microbiology: A Systems Approach, McGraw Hill

 

PART B

Summary:

Directions for the students: There are 4 essay questions. Please be sure to complete all of them with thorough substantive responses. Current APA Citations are required for all responses.

 

1. Precisely what is microbial death?

2. Why does a population of microbes not die instantaneously when exposed to an antimicrobial agent?

3. Explain what is wrong with this statement: “Prior to vaccination, the patient’s skin was sterilized with alcohol.” What would be a more correct wording?

4. Conduct additional research on the use of triclosan and other chemical agents in antimicrobial products today. Develop an opinion on whether this process should continue, providing evidence and citations to support your stance.

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Proving Your Innocence!

/in /by

Activity 8: Proving Your Innocence!

You have been accused of committing murder …

A 1:54am on March 10, 2019 police officers responded to a call that resulted in the discovery of one deceased male. Two witnesses identified you and your parent as suspicious individuals and you both have been charged with the murder. The police have collected DNA evidence from the crime scene and from both of you, and they claim that they have DNA proof that you are murderer! You maintain your innocence and will do everything that you can to bring the true criminal to justice.

Below are nucleotide sequences from your and your parent’s DNA at four STR sites. Determine the number of STRs (short tandem repeats) in the chromosomes for both of you. Look for the sequence “GATA”, and if it is repeated, then count and note the number of repeats. Those numbers have been filled in for you, but you will need to find repeats later on.

 

YOUR CHROMOSOMES:

STR Site 1:

TCTTATGGCAAAACCGATGGACTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAATGTTTCGGGTAGCACCAGGAGTCTGTAGCACGTGCATCTCAACGTGGCGTGCGTACACGGTACG How may STRs? 11

 

STR Site 2:

CTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATCGGTAGGGAGACCGAGAATCTATGATAGATAGATAGATAGATAGATACAACTTTCCAAACACCCCGTGTCGTC How may STRs? 6

 

STR Site 3:

GATTACCTCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAAGGATGAGTGTCAGCCA

How may STRs? 27

 

STR Site 4:

CTATTGTACTAATCGGCTTCAACGAGCCGTACAGGTGGCACCTCAGGAGGGGCCCGCAGGGAGGAAGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAACT How may STRs? 15

 

YOUR PARENT’S CHROMOSOMES:

STR Site 1:

GCCGTGTAATGATAGATAGATAGATAGATAGATAGATAGATAGATAACAACCACACCTTAGCGAATTGATGCGCCGCTTCGGAATACCGTTTTGGCTACCCGTTACTAAGCCCATCGCGATTTTCAGGTATCGT

How may STRs? 9

 

STR Site 2:

CTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATCGGTAGGGAGACCGAGAATCTATGATAGATAGATAGATAGATAGATACAACTTTCCAAACACCCCGTGTCGTC How may STRs? 6

 

STR Site 3:

GATTACCTCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAAGGATGAGTGTCAGCCA

How may STRs? 27

 

STR Site 4:

CCGGAATCAGTGACTTTGACAGGTTTGTGGGGTACAGCAATGAGATAGATAGATACTTGCATAGCTGCGTATGGAGGAAGGAACTCTTGCGTGTTAGTATGTTGACCCCTGTATTACGGATGCGGGTAGAAGA

How may STRs? 3

 

1. Using the values given above, fill in the following table:

  STR Site 1 STR Site 2 STR Site 3 STR Site 4
You        
Your Parent        

 

2. After identifying the STRs in the chromosomes, the police forensic team will need to make copies of the repeated regions in order to use for further DNA analysis. What is the method called in which you “amplify” or replicate DNA in a test tube?

 

 

 

3. After the DNA has been amplified, the forensic team uses gel electrophoresis in order to compare DNA samples. In the gel below, you will find that the crime scene DNA has already been analyzed and plotted along the left side of the gel. Using the numbers of STRs that you determined above, mark the positions of each STR in the gel for you and your parent. (Leave the right two columns blank – you will fill them in later.)

 

4. Based on the gel electrophoresis analysis above, were the police correct that you are in fact the murderer? Why or why not?

 

You maintain your innocence, and through good old-fashioned detective work you are able to identify two additional suspects who were recently arrested breaking into a nearby Circle-K: Theodore Logan and William S. Preston, Esquire. You are able to isolate their DNA from saliva on soda straws.

5. Determine the numbers of STRs at sites 3 &4 for William and Theodore. Note that the numbers of STRs have already been found for their first two sites. Again, look for the repeated sequence of “GATA”. (Hint: use the “Find”/ “Search” function to locate sequence easily.)

 

WILLIAM’S CHROMOSOMES:

STR Site 1:

CGCTTATGGTCCATAGCACATTCATCGCATCCGGGCGTGCTCTATTTGACGATCCCTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACC How may STRs? 19

 

STR Site 2:

CACTCTATTGAGGCATTAACGATAGATAGATAGATAGATAGATAGGAAGGAGATCTGGAATGAACTGGCCTATGTCACAGAAACTGTGCAAATACCCAATGTCGTTAGTGTAGGTTCTGACCCGCACTCTATTG

How may STRs? 6

 

STR Site 3:

TTTACAACTGGGGACATAAACCCTACGCCCATCATCTACTGACGTCCCTGAGGCTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACCAGTTCATGTAATGGGAGAGTATCCGCCGCAAGA

How may STRs?

 

STR Site 4:

GCGACACGGGTAGGATCATCAGTAATAAGAGTAGTGGGAAAGCTCACAGACCACCGCCTATAGGGGGTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAGCG

How may STRs?

 

THEODORE’S CHROMOSOMES:

STR Site 1:

CGGTCGATCCGGAGGGACGGGCCTCAAAGCCGCGTCACGACCGGAGTAAGCTCCCGTGGGCCTGGATAGATAGATAGATAGATAGATAGATAGATAGAACAGCCCTGGTGGGCCCCATCAGCAGCCCGAA

How may STRs? 8

 

STR Site 2:

CGCTTTTCGGGACGCGGGCCGAGGGGCGATGCCTTCCACTAATCGAGGCCGTTCGTTAATACTTGGATAGATAGATAGATAGATAGATATTGCGTTCCTAGCGCCTATATTTGTCTCTTTGCCGGCTTATGTG

How may STRs? 6

 

STR Site 3:

TCGGAGCGCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACTCGGTACACGGTATGAGCAGGCGC How may STRs?

 

STR Site 4:

ATTTAATCTGGCTGAGGTGTAGACGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAATTCCAGGCGGTGCGTCTGCTGTCGGGTCCCTCTGGTGACTGGCTAGATGGACTTGCC

How may STRs?

 

6. Using the values given above, fill in the following table:

  STR Site 1 STR Site 2 STR Site 3 STR Site 4
William        
Theodore        

 

7. Plot the results of your DNA profiles for William and Theodore in the two right columns on the gel in Question 3. Are either of them a match for the DNA at the crime scene, and if so, who?

 

8. Why do you think that it is important to consider multiple STR sites when constructing a DNA profile? (Think about what would happen if the police only looked at STR Site 2.)

 

 

 

25 nucleotides

Crime Scene DNA

Your DNA

Parnent’s DNA

20 nucleotides

15 nucleotides

10 nucleotides

5 nucleotides

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Demographics Lab

/in /by

Demographics Lab 

Due in Week 10 and worth 30 points

Fill out the DEMOGRAPHICS LAB WORKSHEET and submit.

NOTE:

  • Worksheet for Demographics Lab

    Page 2 of 3

     

    Lab 3: Demographics

    Fill this sheet out and submit via the link given in Blackboard.

    · Begin by going to the following website: https://www.learner.org/courses/envsci/interactives/demographics/

    · Then click the link labeled Open Simulator.

    · This will bring up a simulator, which is pre-loaded with demographic data from various countries.

     

    Part 1. Age Structure Diagrams

    1. Using the tool provided on the website, examine the 2015 population, the growth rate, and the age structure diagram for each of the following countries. Match the overall profile of the age structure diagram to one of the shapes given below.

    Shape 1 Shape 2  Shape 3
    Shape 4 Shape 5 Table of Age Structure Shapes to Match

     

    2. Without changing any of the default settings for the country of interest, click the Step button 7 times, which advances the simulation to the year 2050. (Each click of the step button advanced the simulation 5 years).

    Write down the predicted population for 2050, as well as age structure shape that most closely matches the simulation.

    Enter all the data in the following data table:

    Table 1.

    Country 2015

    Population

    		 2015

    Age Structure Shape

    		 2015

    Overall Growth Rate

    		 2050 Population 2050

    Age Structure Shape

    		 2050

    Overall Growth Rate
    USA            
    Brazil            
    Nigeria            

     

    Questions:

    3. What clues from the shape of the age structure diagram tell you whether a population has positive or negative growth rates?

     

    4. In our textbook, Figure 16.12 (p. 324) designates individuals in the ages of 0-14 as “pre-reproductive individuals”, and individuals between the ages of 15 and 44 as “reproductive individuals”. Explain how we can get some idea of whether a population is growing or shrinking by comparing the population levels of pre-reproductive individuals to reproductive individuals.

     

     

     

     

     

     

     

     

    Part 2. Population Momentum

    Call up the information for Nigeria (which is growing at a high rate). Enter the editing menu for the vital rates of birth by clicking on the pencil that is shown in the vital rates chart. When you get into the menu for editing the birth rates, look at the “Use rates from ______” feature. Use the pull down menu to select the values for the United States (which has a lower birth rate).

    Simulate what would happen if Nigeria were to suddenly have the birth rates of the United States. Click the Step button 7 times, which advances the simulation to the year 2050.

    Questions:

    5. What happens to the population immediately after the birth rate is abruptly dropped in this simulation?

    6. After the birth rate went down abruptly, in this simulation, at what point in the future did the simulation show that the population was leveling off or starting to decrease?

    7. Why doesn’t the population level drop immediately when the birth rate is thus diminished?

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Current Event Assignment #2 @Tutorfaith

/in /by

For each Current Event Assignment, you should find a current event that relates to the course material. This current event can be a news article (such as from the New York Times, Tampa Bay Times, or Huffington Post), popular media article (such as from Buzzfeed or Jezebel), advertisement, or a publically available video, and must be CURRENT (i.e. published in 2019). Current events are NOT informational articles on government health websites (e.g. going to the World Health Organization website and finding an article on how to prevent Zika is NOT a current event; instead, that would be a reference you could use from a reputable government/agency website. You would still need to find a current event from which to base your assignment on).

The written product will consist of:

  • A brief summary of your current event (not more than approximately ½ page)
  • A description of how the assigned material relates to the current event; In the description of how the assigned material relates to the current event you should include specific theories, definitions, and concepts.
  • A brief conclusion. Each Current Event Assignment should be at least 2 pages, but no more than3 pages long, excluding the cover sheet and references page. Please do not exceed the page limit. Use one-inch margins, 12-point font, and double space your text. For this assignment, do not use direct quotes from the current event. Upload your assignment through Canvas as a Word attachment. Assignments submitted in other formats will receive a 0.

Current Event Assignment #2

Current Event Assignment #2 should be based on a specific theory, definition or concept from any of the following lectures: The Social, Cultural & Environmental Context of Health Behavior, The Broader Social Context of Health & Behavior, Multilevel Theories & Ecological Levels, or The Ecological Perspective.

  • For current event 2, such theories, definitions, or concepts could include (but are not limited to) relating a current event to the Bronfenbrenner’s ecological systems theory, Flay’s Theory of Triadic Influence, UNICEF Adolescent Well-Being Framework, communication theory, community mobilization, phases of the Precede-Proceed Model, and the Risks and Protective Factors Model. Even though the lectures include child development, youth violence, sexual violence, and other topics, you should not write your assignment on these topics (unless your current even also relates to one of academic concepts described in the lectures); these health concerns were merely used as examples within the lectures and do not represent a specific theory, definition, or concept from the lectures.
 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"