“Evolution of Disease, Humans, and Animals”

“Evolution of Disease, Humans, and Animals”

Note: Online students, please respond to one (1) of the following three (3) bulleted items.

  • In your own words explain the concept of rRNA then suggest three (3) reasons why scientists choose to use rRNA as an Evolutionary Chronometer.
  • Provide a 100-250 word debate as to whether or not you believe that epigenetic marks can be inherited. Next briefly summarize the nature of the information that epigenetic marks store.
  • Read the New York Times article entitled, “Reverse Engineering Birds’ Beaks into Dinosaur Bones” found here then provide a brief summary of the article. Next discuss whether or not you believe that the evolution of birds can be reversed. Why or why not?

Reply to this statement

 

The epigenetic marks can be inherited through the DNA of a certain generation and then passed on through gametes to the coming generation. The inheritance of epigenetic marks do happen and there are some scientific groups figuring out to what extent this happens, there are some groups or subset of genes referred to as imprint genes which have two functions one which comes from the mother and the other one from the farther, either coming from the mother or from the mother their allele is methylated important but only one produces the proteins because they remain elucidated mostly in the early development. It is very important to establish that the phenotype to be inherited is dependent on being passed through the gametes. An illustration of the mice is stressing the mother which is more likely raised, and is referred to as associative changes in the DNA methylation in glucocorticoid receptor gene. This is not done through gametes although there is some behavior interaction in the parents.

 

The organism can be changed by the environmental factors. these changes can be positive and some can be  associated with very bad diseases like cancer, some certain epigenetic marks can be inherited and change their shape due to environmental factors and cellular features over the generations.

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

The Department Of Orthopedics (Musculoskeletal System)

Assignment 3: Writing and Pronunciation

you will write 3 reports and use them as your script for your Week 2 Oral Report. Your writing section for this assignment will include 2 paragraphs for each of these:

The Department of Orthopedics (Musculoskeletal System)
The Department of Pulmonology (Respiratory System)
The Department of Gastroenterology (Digestive System)
In order to earn the maximum credit for the written report you need to incorporate at least 10 medical terms for each department, using them in a manner that demonstrates your knowledge of their meaning.

Include the major or most common diseases or conditions seen in each department.
Include at least three of the principal procedures that are relevant to each department.
Highlight pertinent laboratory and radiological diagnostic services relevant to each department.
Limit your analysis of each department to two paragraphs.
For your oral report for this week, you will read aloud your Written Sections for the Final Project. You can use the built-in recording software on your own computer, or you can use the suggested Audacity Recording Software available for free download and use for PC and Mac computers.

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Calculations Shown

A certain culture of the bacterium Streptococcus A initially has 10 bacteria and is observed to double every 1.5 hours.
(a) Find an exponential model
(b) Estimate the number of bacteria after 34 hours. (Round your answer to the nearest whole number.)
(c) After how many hours will the bacteria count reach 10,000? (Round your answer to one decimal place.)

The fox population in a certain region has a relative growth rate of 8% per year. It is estimated that the population in 2013 was 16,000.
(a) Find a function
(b) Use the function from part (a) to estimate the fox population in the year 2019. (Round your answer to the nearest whole number.)
(c) After how many years will the fox population reach 24,000? (Round your answer to one decimal place.)

The population of a country has a relative growth rate of 2% per year. The government is trying to reduce the growth rate to 1%. The population in 2011 was approximately 120 million. Find the projected population for the year 2040 for the following conditions. (Round your answers to the nearest whole number.)
(a) The relative growth rate remains at 2% per year.
(b) The relative growth rate is reduced to 1% per year.

The count in a culture of bacteria was 200 after 2 hours and 12,800 after 6 hours.
(a) What is the relative rate of growth of the bacteria population? Express your answer as a percentage. (Round your answer to the nearest whole number.)
(b) What was the initial size of the culture? (Round your answer to the nearest whole number.)
(c) Find a function that models the number of bacteria n(t) after t hours. (Enter your answer in the form
n0e^rt.
Round your n0 value to the nearest whole number. Round your r value to two decimal places.)
n(t) = _______
(d) Find the number of bacteria after 4.5 hours. (Round your answer to the nearest hundred.)
e) After how many hours will the number of bacteria reach 25,000? (Round your answer to two decimal places.)

The half-life of radium-226 is 1600 years. Suppose we have a 24-mg sample.
(a) Find a function
m(t) = m02^−t/h
that models the mass remaining after t years.
m(t) = ____________
(b) Find a function
(c) How much of the sample will remain after 3500 years? (Round your answer to one decimal place.)

(d) After how many years will only 17 mg of the sample remain? (Round your answer to one decimal place.)

 

 

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

DNA

I. A double strand of DNA contains the following sequence. 5’ AGTAGGTTTACACTGCTGCCCCACTATCGTATCTTCCCTGAGTGAGCATTG 3’

3’ TCATCCAAATGTGACGACGGGGTGATAGCATAGAAGGGACTCACTCGTAAC 5’

a. Write the 6 reading frames and group nucleotides in codons, i.e. GTACGT= GTA CGT.

b. From the 6 reading frames, is there an open reading frame (ORF)? If yes, which reading frame? Please indicate the start and stop codons in different colors.

 

II. Review blue-white screening in the website below: http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html

 

You are cloning human insulin gene (INS) in the lab using a plasmid, pJET, that contains an ampicillin resistance marker and also a lacZ gene interrupted by a multiple cloning site. You transform the rDNA into competent E. coli cells by electroporation, then plated the transformed E. coli on agar plates containing ampicillin and X-Gal and waited one day until colonies are visible. You then use blue/white screening to help you identify clones that carry INS gene. You observe numerous blue and white colonies on the agar plate.

 

a. What do blue colonies signify? Briefly explain your answer.

 

b. Which colonies (blue, white, or both) would you want to pick for further analysis to check for the successful cloning of the INS gene? Briefly explain your answer.

 

c. If you forgot to add X-gal to the agar selection medium, how would the colonies that grow differ phenotypically from the ones that grow in plates with X-Gal? Briefly explain your answer.

 

d. If you forgot to add ampicillin to the agar selection medium, what other colonies would grow that won’t normally grow in plates with ampicillin? What color would those other colonies most likely be? Briefly explain your answer

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"