Calculations Shown

A certain culture of the bacterium Streptococcus A initially has 10 bacteria and is observed to double every 1.5 hours.
(a) Find an exponential model
(b) Estimate the number of bacteria after 34 hours. (Round your answer to the nearest whole number.)
(c) After how many hours will the bacteria count reach 10,000? (Round your answer to one decimal place.)

The fox population in a certain region has a relative growth rate of 8% per year. It is estimated that the population in 2013 was 16,000.
(a) Find a function
(b) Use the function from part (a) to estimate the fox population in the year 2019. (Round your answer to the nearest whole number.)
(c) After how many years will the fox population reach 24,000? (Round your answer to one decimal place.)

The population of a country has a relative growth rate of 2% per year. The government is trying to reduce the growth rate to 1%. The population in 2011 was approximately 120 million. Find the projected population for the year 2040 for the following conditions. (Round your answers to the nearest whole number.)
(a) The relative growth rate remains at 2% per year.
(b) The relative growth rate is reduced to 1% per year.

The count in a culture of bacteria was 200 after 2 hours and 12,800 after 6 hours.
(a) What is the relative rate of growth of the bacteria population? Express your answer as a percentage. (Round your answer to the nearest whole number.)
(b) What was the initial size of the culture? (Round your answer to the nearest whole number.)
(c) Find a function that models the number of bacteria n(t) after t hours. (Enter your answer in the form
n0e^rt.
Round your n0 value to the nearest whole number. Round your r value to two decimal places.)
n(t) = _______
(d) Find the number of bacteria after 4.5 hours. (Round your answer to the nearest hundred.)
e) After how many hours will the number of bacteria reach 25,000? (Round your answer to two decimal places.)

The half-life of radium-226 is 1600 years. Suppose we have a 24-mg sample.
(a) Find a function
m(t) = m02^−t/h
that models the mass remaining after t years.
m(t) = ____________
(b) Find a function
(c) How much of the sample will remain after 3500 years? (Round your answer to one decimal place.)

(d) After how many years will only 17 mg of the sample remain? (Round your answer to one decimal place.)

 

 

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

DNA

I. A double strand of DNA contains the following sequence. 5’ AGTAGGTTTACACTGCTGCCCCACTATCGTATCTTCCCTGAGTGAGCATTG 3’

3’ TCATCCAAATGTGACGACGGGGTGATAGCATAGAAGGGACTCACTCGTAAC 5’

a. Write the 6 reading frames and group nucleotides in codons, i.e. GTACGT= GTA CGT.

b. From the 6 reading frames, is there an open reading frame (ORF)? If yes, which reading frame? Please indicate the start and stop codons in different colors.

 

II. Review blue-white screening in the website below: http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html

 

You are cloning human insulin gene (INS) in the lab using a plasmid, pJET, that contains an ampicillin resistance marker and also a lacZ gene interrupted by a multiple cloning site. You transform the rDNA into competent E. coli cells by electroporation, then plated the transformed E. coli on agar plates containing ampicillin and X-Gal and waited one day until colonies are visible. You then use blue/white screening to help you identify clones that carry INS gene. You observe numerous blue and white colonies on the agar plate.

 

a. What do blue colonies signify? Briefly explain your answer.

 

b. Which colonies (blue, white, or both) would you want to pick for further analysis to check for the successful cloning of the INS gene? Briefly explain your answer.

 

c. If you forgot to add X-gal to the agar selection medium, how would the colonies that grow differ phenotypically from the ones that grow in plates with X-Gal? Briefly explain your answer.

 

d. If you forgot to add ampicillin to the agar selection medium, what other colonies would grow that won’t normally grow in plates with ampicillin? What color would those other colonies most likely be? Briefly explain your answer

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

True or false: In a DNA molecule, the bases are covalently bonded to each other.

1.  True or false: In a DNA molecule, the bases are covalently bonded to each other.

2. True or false: During DNA replication, the strands of parent DNA are unwound.

3. True or false: The function of messenger RNA (mRNA) is to transfer amino acids to the ribosomes during protein synthesis.

4. True or false: The Genetic Code varies from species to species.

5. True or false: The completion of the Human Genome Project allowed us to sequence all of the human genome and to know the function of all of the genes.

6. In __________ every three bases is a/an _____________ that codes for a/an _____________.

7. True or false: During translation, the anticodon of tRNA pairs with bases in mRNA.

8. The removal of a nucleotide from a gene in the DNA leads to a _______________.

9.  True or false: Cloning is a natural process for some organisms.

10. True or false: Lactose metabolizing enzymes are produced when RNA polymerase binds to the operator on the lac operon in the absence of lactose.

11. If one strand of DNA has the following sequence: CGGCTAATCGCC, what would the sequence of the complimentary strand be?

12. If the codon of an mRNA strand is UGC, the anticodon of the tRNA would be ___________ and the amino acid, ____________, will be added to the growing peptide chain.

13. True or false: In a normal cell, Ras is a continuously active protein that functions in signaling pathways, several of which promote the cell cycle.

14. True or false: Chorionic villi sampling (CVS) is a much safer procedure than amniocentesis because CVS is done later in pregnancy.

15. True or false: Transcriptional control is the most important level of gene control.

16. X-linked recessive disorders often pass from grandfather to granddaughter.

17. True or false: After it is synthesized, mRNA may linger in the nucleus before moving into the cytoplasm.

18. True or false: Two parents are affected with a genetic disorder. They produce an unaffected child. The disorder is likely transmitted as an autosomal dominant trait.

19. True or false: An enhancer region of DNA is adjacent to the promoter.

20. True or false: The only two methods by which fetal cells can be obtained for testing are amniocentesis and chorionic villi sampling.

21. What purpose does a cell-signaling pathway serve in a multicellular organism?

22. True or false: Some genetic mutations can be determined by testing for proteins.

23. True or false: A regulatory gene codes for a protein that activates the genes in an operon.

24. True or false: Cancer cells show a high degree of contact inhibition.

25. The major way in which therapeutic cloning and reproductive cloning differ is what?

26. True or false: Proto-oncogenes may code for growth factors.

27. True or false: Telomerase is highly active in cancer cells.

28. True or false: Angiogensis is not a suspected cause of cancer.

29. True or false: A karyotype can be done using any cell in the body.

30. True or false: An exchange of chromosomal segments between two nonhomologous chromosomes is a/an translocation.

31.  In a duplication, a person has more than two alleles for a certain trait.

32. In an autosomal dominant genetic disorder, if both parents have the disorder, what is the chance that their sons will have the disorder?

33. A male has a particular X-linked recessive genetic disorder. His partner is normal, but her father had the disorder. What is the chance that their sons will have the disorder?

34. Phenylketonuria (PKU) is an autosomal Phenylketonuria (PKU) is an autosomal recessive disorder. If a woman who does not have PKU gives birth to a child who has PKU, which of the following men, based on this information alone, could not be the father of the child?

35. True or false: An abnormality in DNA sequence used in a test to determine an abnormal allele is called a genetic marker.

36. True or false: A genetic profile can detect mutations in a person’s genes.

37. The insertion of genetic material into human cells for treatment of a disorder is called what?

39. What is the difference between ex vivo gene therapy and in vivo gene therapy?

40. True or false: Ultrasound images determine the karyotype of the fetus.

41. An autosomal recessive disorder that occurs among all ethnic groups, in which chloride ions fail to pass through a plasma membrane channel protein in the cells and leads these patients to develop thick mucus in their bronchial tubes and pancreatic ducts is ________.

42. What disorders are present only in males and are passed from father to all sons but not to daughters.

43. True or false: mRNA processing occurs after transcription.

44. A testable explanation of a broad range of related phenomena that is relied upon by scientists with a high degree of confidence is referred to as ________.

45. The smaller unit molecules (monomers) which combine to form proteins and polypeptides are called ____________.

46. Enzymes, some hormones, and structural molecules like keratin and collagen are examples of ______________.

47. An atom that has gained or lost electrons is referred to as _______________.

48. Cell membranes consist of _____________.

49.  Which transport mechanism requires ATP to move materials across a plasma membrane?

50. A cell is placed in a solution.  If the cell is observed to shrink, the solution must be _________________ relative to the interior of the cell.

51.  What are the 1st and 2nd energy laws?

52. In higher cells, cellular (aerobic) respiration with production of adenosine triphosphate (ATP) is carried out in the _______________.

53. Meiosis differs from mitosis because _______________.

54. Leaves are green because ____________.

55. Many human traits such as eye color and height are controlled by _______________.

56. ______________ is a nucleic acid base found in ribonucleic acid (RNA) but not in deoxyribonucleic acid (DNA).

57. The polymerase chain reaction (PCR) is a method of ________________.

58. The normal complement of sex chromosomes for a human male is ___________.

59. An allele is ____________.

60. A visual display of metaphase chromosomes arranged by size, shape, and banding pattern is ______.

61. The part of an enzyme that “fits” its substrate is called its __________ site.

62. True or false: recombinant deoxyribonucleic acid (rDNA) technology estimates the age of a rock sample.

 

63. True or false: A mutation of a tumor suppressor gene is most likely to cause a cell to become cancerous.

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"

Nutriton Discussion Board

For Biology Nutrition… Needs to be lengthy but more like a big paragraph for each question!

 

1. What are some unique challenges we face in the realm of nutritional health for children? Address specific challenges we face today. (development of poor eating habits, processed foods, etc..)

2. What are some unique challenges we face in the realm of nutritional health for pregnant/lactating women? How do we encourage good nutritional behavior by pregnant/lactating women without violating individual liberties?

3. How can global issues hinder the nutritional needs of some populations? Give examples.  How do we combat these issues?

4. As we approach the end of this class you will start to see some data on the disturbing trends in the United States on the obesity epidemic and its effects on our health as a society.  The past several years of the healthcare debate have created much controversy. Many people look at healthcare as something that should be paid for by tax dollars, as we all benefit from a healthy society, just as we all benefit from roads and bridges.

5.Many people also feel personal health is one’s personal responsibility as the bulk of healthcare costs are due to personal choices and are to be bore by the individual, just as if they had chose to drink or do drugs.

6.How do we grapple with the healthcare issue? What do you think?  Support your sentiments with logic and facts and not emotion.  Saying that you think its a good thing for everyone to have healthcare isn’t disputed. I think most people would say that’s a good thing! However, who would pay for that?  And why? Where do the roles of individuals and taxpayers meet?

 
"Looking for a Similar Assignment? Get Expert Help at an Amazing Discount!"